Incidental Mutation 'R0591:Slc44a5'
ID55967
Institutional Source Beutler Lab
Gene Symbol Slc44a5
Ensembl Gene ENSMUSG00000028360
Gene Namesolute carrier family 44, member 5
SynonymsLOC242259
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0591 (G1)
Quality Score138
Status Validated
Chromosome3
Chromosomal Location153973436-154271722 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 154234145 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089948]
Predicted Effect probably benign
Transcript: ENSMUST00000089948
SMART Domains Protein: ENSMUSP00000087394
Gene: ENSMUSG00000028360

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 263 285 N/A INTRINSIC
Pfam:Choline_transpo 323 683 6.3e-114 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Slc44a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc44a5 APN 3 154262939 missense probably damaging 1.00
IGL02187:Slc44a5 APN 3 154262917 missense probably benign 0.00
IGL02219:Slc44a5 APN 3 154239159 missense possibly damaging 0.76
IGL02220:Slc44a5 APN 3 154250971 missense possibly damaging 0.94
IGL02314:Slc44a5 APN 3 154256519 missense probably damaging 1.00
IGL02471:Slc44a5 APN 3 154256576 missense probably damaging 1.00
IGL02869:Slc44a5 APN 3 154251014 missense probably damaging 0.97
IGL03117:Slc44a5 APN 3 154251077 missense probably benign 0.15
IGL03144:Slc44a5 APN 3 154243540 missense possibly damaging 0.78
PIT4486001:Slc44a5 UTSW 3 154259022 missense possibly damaging 0.50
R0026:Slc44a5 UTSW 3 154240270 splice site probably benign
R0190:Slc44a5 UTSW 3 154239118 missense probably null 0.00
R0306:Slc44a5 UTSW 3 154270001 missense probably damaging 1.00
R0744:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0833:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0919:Slc44a5 UTSW 3 154243586 missense probably damaging 1.00
R1170:Slc44a5 UTSW 3 154257720 intron probably null
R1370:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R1613:Slc44a5 UTSW 3 154257714 intron probably null
R1713:Slc44a5 UTSW 3 154239106 missense probably damaging 0.97
R1999:Slc44a5 UTSW 3 154258493 missense possibly damaging 0.61
R2143:Slc44a5 UTSW 3 154258449 missense probably benign 0.01
R2293:Slc44a5 UTSW 3 154240297 missense probably benign 0.01
R2367:Slc44a5 UTSW 3 154247809 missense possibly damaging 0.94
R3842:Slc44a5 UTSW 3 154261394 splice site probably benign
R3953:Slc44a5 UTSW 3 154171572 missense probably benign 0.03
R4163:Slc44a5 UTSW 3 154261373 missense possibly damaging 0.94
R4509:Slc44a5 UTSW 3 154234073 missense probably damaging 1.00
R4657:Slc44a5 UTSW 3 154256584 missense possibly damaging 0.81
R4936:Slc44a5 UTSW 3 154253716 missense probably damaging 1.00
R4937:Slc44a5 UTSW 3 154243615 critical splice donor site probably null
R5083:Slc44a5 UTSW 3 154247787 missense probably benign 0.31
R5257:Slc44a5 UTSW 3 154243123 missense probably damaging 1.00
R5580:Slc44a5 UTSW 3 154261285 missense probably benign 0.03
R5586:Slc44a5 UTSW 3 154270165 utr 3 prime probably benign
R5856:Slc44a5 UTSW 3 154258392 missense possibly damaging 0.78
R5894:Slc44a5 UTSW 3 154256573 missense probably damaging 1.00
R6228:Slc44a5 UTSW 3 154239163 missense probably benign 0.00
R6248:Slc44a5 UTSW 3 154264041 missense possibly damaging 0.93
R6413:Slc44a5 UTSW 3 154257750 missense probably benign 0.21
R6454:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R6594:Slc44a5 UTSW 3 154259023 missense possibly damaging 0.85
R6761:Slc44a5 UTSW 3 154240077 intron probably null
R6931:Slc44a5 UTSW 3 154258506 missense probably benign 0.03
R7027:Slc44a5 UTSW 3 154253719 missense probably benign 0.00
R7566:Slc44a5 UTSW 3 154269989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGCACAGAAAATGGAGCTGACC -3'
(R):5'- AGCAGACGACAAGGACTTCTGGAC -3'

Sequencing Primer
(F):5'- AAAGGCAACGAATTCAACATTTTTG -3'
(R):5'- CAAGGACTTCTGGACTGTGAC -3'
Posted On2013-07-11