Incidental Mutation 'R7193:Ccng2'
ID559713
Institutional Source Beutler Lab
Gene Symbol Ccng2
Ensembl Gene ENSMUSG00000029385
Gene Namecyclin G2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location93267257-93276231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 93273343 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 237 (S237R)
Ref Sequence ENSEMBL: ENSMUSP00000113278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031331] [ENSMUST00000121127]
Predicted Effect probably benign
Transcript: ENSMUST00000031331
AA Change: S237R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031331
Gene: ENSMUSG00000029385
AA Change: S237R

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121127
AA Change: S237R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113278
Gene: ENSMUSG00000029385
AA Change: S237R

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153260
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The 8 species of cyclins reported in mammals, cyclins A through H, share a conserved amino acid sequence of about 90 residues called the cyclin box. The amino acid sequence of cyclin G is well conserved among mammals. The nucleotide sequence of cyclin G1 and cyclin G2 are 53% identical. Unlike cyclin G1, cyclin G2 contains a C-terminal PEST protein destabilization motif, suggesting that cyclin G2 expression is tightly regulated through the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Ccng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Ccng2 APN 5 93270887 missense probably damaging 0.99
IGL01289:Ccng2 APN 5 93273417 missense probably null 0.88
R0133:Ccng2 UTSW 5 93273381 missense probably benign 0.15
R0266:Ccng2 UTSW 5 93271289 splice site probably benign
R0346:Ccng2 UTSW 5 93270894 missense probably damaging 1.00
R0401:Ccng2 UTSW 5 93273413 missense possibly damaging 0.52
R1087:Ccng2 UTSW 5 93273444 missense probably benign 0.17
R1373:Ccng2 UTSW 5 93271055 splice site probably benign
R1696:Ccng2 UTSW 5 93273382 missense possibly damaging 0.90
R3727:Ccng2 UTSW 5 93274951 missense probably damaging 1.00
R5395:Ccng2 UTSW 5 93269398 missense possibly damaging 0.84
R6337:Ccng2 UTSW 5 93270921 missense probably benign
R6611:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7077:Ccng2 UTSW 5 93269340 missense possibly damaging 0.91
R7140:Ccng2 UTSW 5 93268755 missense probably benign 0.00
R7161:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7233:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7235:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7269:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7270:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7271:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7449:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7451:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7567:Ccng2 UTSW 5 93270872 missense probably benign 0.01
R7614:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7657:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7658:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7743:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7744:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7745:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7874:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7875:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7876:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7877:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7884:Ccng2 UTSW 5 93273343 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGTGTAAGTAATACTTGGAGTG -3'
(R):5'- TTTCACTTCCGTCAAAGCAACC -3'

Sequencing Primer
(F):5'- GGAGTGTTATTTCAACCAGCAGTTCC -3'
(R):5'- GAACACTGTAGTAGCTGC -3'
Posted On2019-06-26