Incidental Mutation 'R7193:Zfp606'
ID559718
Institutional Source Beutler Lab
Gene Symbol Zfp606
Ensembl Gene ENSMUSG00000030386
Gene Namezinc finger protein 606
Synonyms2410022M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12478293-12496235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12494039 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 696 (S696A)
Ref Sequence ENSEMBL: ENSMUSP00000096421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098822] [ENSMUST00000151933] [ENSMUST00000209403]
Predicted Effect probably benign
Transcript: ENSMUST00000098822
AA Change: S696A

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096421
Gene: ENSMUSG00000030386
AA Change: S696A

DomainStartEndE-ValueType
KRAB 63 123 3.36e-39 SMART
ZnF_C2H2 291 313 1.83e2 SMART
ZnF_C2H2 403 425 2.89e1 SMART
ZnF_C2H2 431 453 2.3e-5 SMART
ZnF_C2H2 459 481 1.28e-3 SMART
ZnF_C2H2 487 509 3.95e-4 SMART
ZnF_C2H2 515 537 5.67e-5 SMART
ZnF_C2H2 543 565 6.88e-4 SMART
ZnF_C2H2 571 593 9.22e-5 SMART
ZnF_C2H2 599 621 1.95e-3 SMART
ZnF_C2H2 627 649 1.47e-3 SMART
ZnF_C2H2 655 677 3.39e-3 SMART
ZnF_C2H2 683 705 4.11e-2 SMART
ZnF_C2H2 711 733 4.87e-4 SMART
ZnF_C2H2 739 761 1.67e-2 SMART
ZnF_C2H2 767 789 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151933
SMART Domains Protein: ENSMUSP00000122197
Gene: ENSMUSG00000030386

DomainStartEndE-ValueType
KRAB 5 65 3.36e-39 SMART
ZnF_C2H2 233 255 1.83e2 SMART
ZnF_C2H2 345 367 2.89e1 SMART
ZnF_C2H2 373 395 2.3e-5 SMART
ZnF_C2H2 401 423 1.28e-3 SMART
ZnF_C2H2 429 451 3.95e-4 SMART
ZnF_C2H2 457 479 5.67e-5 SMART
ZnF_C2H2 485 507 6.88e-4 SMART
ZnF_C2H2 513 535 9.22e-5 SMART
ZnF_C2H2 541 563 1.95e-3 SMART
ZnF_C2H2 569 591 1.47e-3 SMART
ZnF_C2H2 597 619 3.39e-3 SMART
ZnF_C2H2 625 647 4.11e-2 SMART
ZnF_C2H2 653 675 4.87e-4 SMART
ZnF_C2H2 681 703 1.67e-2 SMART
ZnF_C2H2 709 731 2.4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209403
AA Change: S638A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein containing a Kruppel-associated box (KRAB) domain at its N-terminus, followed by contiguous C2H2 zinc finger motifs. The encoded protein is a nuclear protein that can act as a transcriptional repressor of growth factor-mediated signaling pathways in a reporter gene assay. This protein has been shown to interact with the SRY-box 9 gene product, and suppresses its transcriptional activity by inhibiting its DNA binding activity. Reduced expression of this gene promotes chondrocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Other mutations in Zfp606
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1680:Zfp606 UTSW 7 12493971 missense probably damaging 1.00
R1861:Zfp606 UTSW 7 12480931 unclassified probably benign
R1943:Zfp606 UTSW 7 12493688 missense probably damaging 1.00
R2142:Zfp606 UTSW 7 12479726 missense probably damaging 0.99
R2340:Zfp606 UTSW 7 12493089 missense possibly damaging 0.91
R3426:Zfp606 UTSW 7 12489664 missense probably damaging 0.99
R4208:Zfp606 UTSW 7 12494175 missense probably damaging 1.00
R4258:Zfp606 UTSW 7 12494340 unclassified probably null
R4383:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R4393:Zfp606 UTSW 7 12492849 missense probably damaging 1.00
R4782:Zfp606 UTSW 7 12494005 missense probably damaging 1.00
R4858:Zfp606 UTSW 7 12493056 missense possibly damaging 0.89
R5668:Zfp606 UTSW 7 12492552 missense probably benign 0.28
R5704:Zfp606 UTSW 7 12493529 missense probably damaging 0.99
R6064:Zfp606 UTSW 7 12481033 missense possibly damaging 0.82
R6080:Zfp606 UTSW 7 12494116 missense probably damaging 1.00
R6190:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R6383:Zfp606 UTSW 7 12492944 missense probably benign 0.18
R6964:Zfp606 UTSW 7 12489592 missense probably damaging 1.00
R7507:Zfp606 UTSW 7 12492941 missense probably benign 0.18
R7997:Zfp606 UTSW 7 12489592 missense probably damaging 1.00
R7997:Zfp606 UTSW 7 12494207 missense possibly damaging 0.86
Z1176:Zfp606 UTSW 7 12481025 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGGCTCATCTTGTTAGGCATC -3'
(R):5'- TGATGTTGAAGTAAGGCCGAATGAC -3'

Sequencing Primer
(F):5'- GCTCATCTTGTTAGGCATCAAAGGAC -3'
(R):5'- AAAGGCTCTTCCACACTGATTG -3'
Posted On2019-06-26