Incidental Mutation 'R7193:Acan'
ID559721
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79086342 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 179 (S179C)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
AlphaFold Q61282
Predicted Effect probably damaging
Transcript: ENSMUST00000032835
AA Change: S179C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: S179C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Disproportion UTSW 7 79092318 missense probably damaging 0.98
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
R8482:Acan UTSW 7 79096744 missense probably benign 0.02
R8511:Acan UTSW 7 79097935 missense possibly damaging 0.94
R8716:Acan UTSW 7 79112690 missense probably damaging 1.00
R8753:Acan UTSW 7 79098768 missense possibly damaging 0.83
R8810:Acan UTSW 7 79099704 missense probably damaging 1.00
R8898:Acan UTSW 7 79100353 missense possibly damaging 0.59
R8956:Acan UTSW 7 79100965 missense probably benign 0.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTATGTCAGCCTAGACCAGAC -3'
(R):5'- ATTATGTTTGTACCAGCTCAGTGC -3'

Sequencing Primer
(F):5'- GTCAGCCTAGACCAGACAGTGC -3'
(R):5'- CAGCTCAGTGCAGGTCATTGTC -3'
Posted On2019-06-26