Incidental Mutation 'R7193:Abca16'
ID559723
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120427186 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 124 (S124P)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
Predicted Effect probably damaging
Transcript: ENSMUST00000056042
AA Change: S124P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: S124P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120490
AA Change: S124P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: S124P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120519988 missense probably benign 0.11
R7617:Abca16 UTSW 7 120503471 nonsense probably null
R7646:Abca16 UTSW 7 120514714 missense probably benign 0.04
R7750:Abca16 UTSW 7 120514705 missense probably benign 0.09
R7763:Abca16 UTSW 7 120514602 missense probably damaging 1.00
RF020:Abca16 UTSW 7 120533657 missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATGCTTCCTGCCCTCTAG -3'
(R):5'- CCTTCTCCATTTGTAAAATTGGGC -3'

Sequencing Primer
(F):5'- CCTCTAGACTGTCCTGGTTGG -3'
(R):5'- ATCCTAGAAGGTAAAGGTACT -3'
Posted On2019-06-26