Incidental Mutation 'R7193:Rnf185'
ID 559730
Institutional Source Beutler Lab
Gene Symbol Rnf185
Ensembl Gene ENSMUSG00000020448
Gene Name ring finger protein 185
Synonyms 1700022N24Rik
MMRRC Submission 045334-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.334) question?
Stock # R7193 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 3365982-3402363 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3375329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 142 (T142A)
Ref Sequence ENSEMBL: ENSMUSP00000067053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064364] [ENSMUST00000077078]
AlphaFold Q91YT2
Predicted Effect possibly damaging
Transcript: ENSMUST00000064364
AA Change: T142A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067053
Gene: ENSMUSG00000020448
AA Change: T142A

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
RING 75 115 9.23e-9 SMART
low complexity region 143 154 N/A INTRINSIC
transmembrane domain 167 189 N/A INTRINSIC
transmembrane domain 209 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077078
AA Change: T106A

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076333
Gene: ENSMUSG00000020448
AA Change: T106A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
RING 39 79 9.23e-9 SMART
low complexity region 107 118 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
transmembrane domain 173 191 N/A INTRINSIC
Meta Mutation Damage Score 0.0666 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,265,963 (GRCm39) probably null Het
Abca16 T C 7: 120,026,409 (GRCm39) S124P probably damaging Het
Acan A T 7: 78,736,090 (GRCm39) S179C probably damaging Het
Atg2b A C 12: 105,630,967 (GRCm39) H319Q probably damaging Het
Bptf G A 11: 106,945,635 (GRCm39) Q2535* probably null Het
Brpf3 T C 17: 29,055,665 (GRCm39) *1205R probably null Het
Cabyr C A 18: 12,884,815 (GRCm39) P434Q probably damaging Het
Cacna1g C A 11: 94,300,057 (GRCm39) D2268Y possibly damaging Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cct4 A G 11: 22,947,111 (GRCm39) T201A probably benign Het
Cdyl2 A C 8: 117,350,733 (GRCm39) S133A probably benign Het
Cep76 A G 18: 67,774,204 (GRCm39) L14P possibly damaging Het
Cert1 T A 13: 96,767,341 (GRCm39) probably null Het
Crybg3 A T 16: 59,379,956 (GRCm39) S433T possibly damaging Het
Cul9 T C 17: 46,849,423 (GRCm39) K574R probably damaging Het
Cyp2u1 T C 3: 131,084,792 (GRCm39) I527V probably benign Het
Dnaaf9 C A 2: 130,648,708 (GRCm39) R258L unknown Het
Eif4a3l1 A T 6: 136,306,213 (GRCm39) I225F probably damaging Het
F5 A G 1: 164,046,966 (GRCm39) N2142S probably damaging Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Flnc A G 6: 29,450,870 (GRCm39) Y1506C probably damaging Het
Foxred2 T A 15: 77,836,230 (GRCm39) S376C probably damaging Het
Gbe1 T C 16: 70,292,258 (GRCm39) L530P probably damaging Het
Hmcn1 T C 1: 150,525,331 (GRCm39) R3398G probably null Het
Igf1r T C 7: 67,836,905 (GRCm39) L587P probably damaging Het
Ints15 A G 5: 143,293,598 (GRCm39) V293A probably benign Het
Kcna3 T C 3: 106,943,853 (GRCm39) Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 141,728,980 (GRCm39) probably benign Het
Mbl1 T C 14: 40,880,669 (GRCm39) F186L probably damaging Het
Ncam2 A T 16: 81,386,683 (GRCm39) K687N probably damaging Het
Nedd4l T C 18: 65,130,441 (GRCm39) V24A probably damaging Het
Nek1 A G 8: 61,526,612 (GRCm39) E661G probably damaging Het
Nudt14 G T 12: 112,902,940 (GRCm39) D28E probably benign Het
Or13n4 T C 7: 106,423,798 (GRCm39) probably benign Het
Or1j15 T A 2: 36,459,248 (GRCm39) C213S probably benign Het
Or2n1 T A 17: 38,485,987 (GRCm39) I4N probably benign Het
Or4k47 A T 2: 111,451,600 (GRCm39) V273E probably damaging Het
Pdk4 A T 6: 5,487,089 (GRCm39) M319K probably benign Het
Pfkp T C 13: 6,643,252 (GRCm39) N522S probably benign Het
Pias2 T C 18: 77,207,817 (GRCm39) V234A possibly damaging Het
Pik3c2b C A 1: 133,007,512 (GRCm39) H625Q probably benign Het
Pnpla7 T C 2: 24,941,627 (GRCm39) S1117P probably damaging Het
Prdm2 A T 4: 142,907,464 (GRCm39) V36D probably damaging Het
Prep C T 10: 44,968,795 (GRCm39) R98C probably benign Het
Rae1 T C 2: 172,850,110 (GRCm39) probably null Het
Rgs3 T A 4: 62,533,573 (GRCm39) V138E probably damaging Het
Rsph6a C A 7: 18,799,572 (GRCm39) P401Q probably damaging Het
Runx3 A T 4: 134,848,456 (GRCm39) T14S probably benign Het
Scaf11 A G 15: 96,317,042 (GRCm39) S841P probably damaging Het
Spta1 T A 1: 174,012,178 (GRCm39) L328Q probably damaging Het
Sqor G A 2: 122,645,929 (GRCm39) V318M probably damaging Het
Stox2 T C 8: 47,639,489 (GRCm39) T902A probably benign Het
Susd3 T C 13: 49,384,679 (GRCm39) H248R probably damaging Het
Syne1 T C 10: 5,183,406 (GRCm39) Y4133C probably damaging Het
Tbc1d20 C T 2: 152,153,337 (GRCm39) T289M probably benign Het
Unc80 T A 1: 66,588,943 (GRCm39) F1036Y possibly damaging Het
Zbtb7c T C 18: 76,271,009 (GRCm39) C366R probably damaging Het
Zeb1 A T 18: 5,772,756 (GRCm39) D1015V probably damaging Het
Zfp606 T G 7: 12,227,966 (GRCm39) S696A probably benign Het
Other mutations in Rnf185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02363:Rnf185 APN 11 3,368,015 (GRCm39) missense possibly damaging 0.79
R0026:Rnf185 UTSW 11 3,376,617 (GRCm39) missense probably damaging 0.99
R2111:Rnf185 UTSW 11 3,382,393 (GRCm39) splice site probably benign
R2225:Rnf185 UTSW 11 3,382,445 (GRCm39) missense probably damaging 1.00
R2508:Rnf185 UTSW 11 3,368,067 (GRCm39) missense probably benign 0.00
R3907:Rnf185 UTSW 11 3,376,681 (GRCm39) splice site probably benign
R4767:Rnf185 UTSW 11 3,382,551 (GRCm39) missense possibly damaging 0.83
R7449:Rnf185 UTSW 11 3,376,578 (GRCm39) missense probably benign 0.27
R8754:Rnf185 UTSW 11 3,368,052 (GRCm39) missense probably benign 0.12
R9404:Rnf185 UTSW 11 3,382,615 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAATCTCTGGATGAGTGGTTC -3'
(R):5'- GTAGGCTGTGCAATCTGATAGC -3'

Sequencing Primer
(F):5'- AGTGGTTCTAGGATTTTTCCCTGC -3'
(R):5'- AGCTCTCTTAGAACAAGCTGG -3'
Posted On 2019-06-26