Incidental Mutation 'R7193:Rnf185'
ID 559730
Institutional Source Beutler Lab
Gene Symbol Rnf185
Ensembl Gene ENSMUSG00000020448
Gene Name ring finger protein 185
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock # R7193 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 3415982-3452363 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3425329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 142 (T142A)
Ref Sequence ENSEMBL: ENSMUSP00000067053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064364] [ENSMUST00000077078]
AlphaFold Q91YT2
Predicted Effect possibly damaging
Transcript: ENSMUST00000064364
AA Change: T142A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067053
Gene: ENSMUSG00000020448
AA Change: T142A

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
RING 75 115 9.23e-9 SMART
low complexity region 143 154 N/A INTRINSIC
transmembrane domain 167 189 N/A INTRINSIC
transmembrane domain 209 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077078
AA Change: T106A

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076333
Gene: ENSMUSG00000020448
AA Change: T106A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
RING 39 79 9.23e-9 SMART
low complexity region 107 118 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
transmembrane domain 173 191 N/A INTRINSIC
Meta Mutation Damage Score 0.0666 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Rnf185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02363:Rnf185 APN 11 3418015 missense possibly damaging 0.79
R0026:Rnf185 UTSW 11 3426617 missense probably damaging 0.99
R2111:Rnf185 UTSW 11 3432393 splice site probably benign
R2225:Rnf185 UTSW 11 3432445 missense probably damaging 1.00
R2508:Rnf185 UTSW 11 3418067 missense probably benign 0.00
R3907:Rnf185 UTSW 11 3426681 splice site probably benign
R4767:Rnf185 UTSW 11 3432551 missense possibly damaging 0.83
R7449:Rnf185 UTSW 11 3426578 missense probably benign 0.27
R8754:Rnf185 UTSW 11 3418052 missense probably benign 0.12
R9404:Rnf185 UTSW 11 3432615 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAATCTCTGGATGAGTGGTTC -3'
(R):5'- GTAGGCTGTGCAATCTGATAGC -3'

Sequencing Primer
(F):5'- AGTGGTTCTAGGATTTTTCCCTGC -3'
(R):5'- AGCTCTCTTAGAACAAGCTGG -3'
Posted On 2019-06-26