Incidental Mutation 'R7193:Atg2b'
ID559735
Institutional Source Beutler Lab
Gene Symbol Atg2b
Ensembl Gene ENSMUSG00000041341
Gene Nameautophagy related 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location105616136-105685211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105664708 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 319 (H319Q)
Ref Sequence ENSEMBL: ENSMUSP00000037441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041055]
Predicted Effect probably damaging
Transcript: ENSMUST00000041055
AA Change: H319Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: H319Q

DomainStartEndE-ValueType
Pfam:Chorein_N 11 127 3.5e-19 PFAM
low complexity region 286 298 N/A INTRINSIC
low complexity region 409 428 N/A INTRINSIC
low complexity region 864 870 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
Pfam:ATG_C 1976 2071 1.4e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zeb1 A T 18: 5,772,756 D1015V probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Atg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Atg2b APN 12 105644916 missense probably benign 0.20
IGL01326:Atg2b APN 12 105622144 missense probably damaging 1.00
IGL02063:Atg2b APN 12 105648322 missense possibly damaging 0.89
IGL02260:Atg2b APN 12 105636440 splice site probably benign
IGL02376:Atg2b APN 12 105645468 missense probably damaging 1.00
IGL02381:Atg2b APN 12 105648348 missense probably damaging 1.00
IGL02434:Atg2b APN 12 105639207 missense probably benign 0.00
IGL02534:Atg2b APN 12 105643267 missense probably damaging 1.00
IGL03011:Atg2b APN 12 105626362 missense probably damaging 0.98
IGL03173:Atg2b APN 12 105658294 missense possibly damaging 0.68
R6669_atg2b_067 UTSW 12 105671529 missense possibly damaging 0.90
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0066:Atg2b UTSW 12 105648449 missense probably benign
R0511:Atg2b UTSW 12 105617153 missense probably damaging 1.00
R0762:Atg2b UTSW 12 105674970 missense possibly damaging 0.56
R0786:Atg2b UTSW 12 105636508 missense probably benign 0.00
R1029:Atg2b UTSW 12 105635773 missense probably damaging 0.96
R1529:Atg2b UTSW 12 105661133 missense probably benign
R1563:Atg2b UTSW 12 105623488 missense probably damaging 0.99
R1746:Atg2b UTSW 12 105669329 missense possibly damaging 0.79
R1887:Atg2b UTSW 12 105654092 missense probably benign 0.01
R1956:Atg2b UTSW 12 105669418 missense probably damaging 1.00
R1957:Atg2b UTSW 12 105669418 missense probably damaging 1.00
R2272:Atg2b UTSW 12 105638008 missense probably benign 0.00
R2877:Atg2b UTSW 12 105664009 nonsense probably null
R2878:Atg2b UTSW 12 105664009 nonsense probably null
R4798:Atg2b UTSW 12 105652629 missense probably benign 0.37
R4836:Atg2b UTSW 12 105646814 missense probably benign
R5007:Atg2b UTSW 12 105643876 splice site probably null
R5042:Atg2b UTSW 12 105621262 missense probably benign 0.01
R5134:Atg2b UTSW 12 105674950 missense probably damaging 0.96
R5212:Atg2b UTSW 12 105646796 missense probably benign 0.00
R5250:Atg2b UTSW 12 105635765 missense probably damaging 1.00
R5307:Atg2b UTSW 12 105658329 missense probably benign 0.17
R5342:Atg2b UTSW 12 105658916 missense possibly damaging 0.90
R5583:Atg2b UTSW 12 105649155 missense possibly damaging 0.94
R5656:Atg2b UTSW 12 105621328 missense probably benign 0.00
R5660:Atg2b UTSW 12 105649124 nonsense probably null
R5903:Atg2b UTSW 12 105639359 missense possibly damaging 0.90
R6018:Atg2b UTSW 12 105661171 missense probably damaging 0.96
R6153:Atg2b UTSW 12 105623482 missense possibly damaging 0.80
R6326:Atg2b UTSW 12 105661092 nonsense probably null
R6584:Atg2b UTSW 12 105657995 missense probably damaging 1.00
R6593:Atg2b UTSW 12 105644848 missense probably damaging 1.00
R6669:Atg2b UTSW 12 105671529 missense possibly damaging 0.90
R6847:Atg2b UTSW 12 105635788 missense probably damaging 1.00
R7003:Atg2b UTSW 12 105654249 missense probably benign 0.01
R7387:Atg2b UTSW 12 105622775 missense probably damaging 1.00
R7432:Atg2b UTSW 12 105661204 missense probably damaging 0.98
R7432:Atg2b UTSW 12 105664698 missense probably benign 0.08
R7630:Atg2b UTSW 12 105646954 critical splice acceptor site probably null
R7634:Atg2b UTSW 12 105652120 missense probably damaging 1.00
R7645:Atg2b UTSW 12 105623430 missense probably benign 0.06
R7653:Atg2b UTSW 12 105636472 missense possibly damaging 0.68
X0018:Atg2b UTSW 12 105666697 missense possibly damaging 0.86
X0066:Atg2b UTSW 12 105646785 missense probably benign 0.12
Z1177:Atg2b UTSW 12 105635764 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTTCTCCAACCAAAGATACAGG -3'
(R):5'- CGTTGCAGGTCTTTATGCTC -3'

Sequencing Primer
(F):5'- CCAATAAAGTAACCAGGATATCTAC -3'
(R):5'- GCAGGTCTTTATGCTCTTTTATTGAG -3'
Posted On2019-06-26