Incidental Mutation 'R7193:Zeb1'
ID559750
Institutional Source Beutler Lab
Gene Symbol Zeb1
Ensembl Gene ENSMUSG00000024238
Gene Namezinc finger E-box binding homeobox 1
Synonyms3110032K11Rik, Tw, MEB1, Zfhx1a, Zfhep, ZEB, AREB6, Zfx1a, Tcf18, Nil2, Tcf8, [delta]EF1
MMRRC Submission
Accession Numbers

Genbank: NM_011546; MGI: 1344313

Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock #R7193 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location5591860-5775467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5772756 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1015 (D1015V)
Ref Sequence ENSEMBL: ENSMUSP00000025081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025081]
Predicted Effect probably damaging
Transcript: ENSMUST00000025081
AA Change: D1015V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: D1015V

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 150 173 3.16e-3 SMART
ZnF_C2H2 180 202 3.21e-4 SMART
ZnF_C2H2 220 242 4.87e-4 SMART
ZnF_C2H2 248 268 1.86e1 SMART
low complexity region 288 304 N/A INTRINSIC
low complexity region 532 555 N/A INTRINSIC
HOX 559 621 7.53e-3 SMART
low complexity region 730 742 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
ZnF_C2H2 882 904 1.18e-2 SMART
ZnF_C2H2 910 932 4.4e-2 SMART
ZnF_C2H2 938 959 1.89e-1 SMART
coiled coil region 1006 1077 N/A INTRINSIC
low complexity region 1096 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,189 probably null Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca16 T C 7: 120,427,186 S124P probably damaging Het
Acan A T 7: 79,086,342 S179C probably damaging Het
Atg2b A C 12: 105,664,708 H319Q probably damaging Het
Bptf G A 11: 107,054,809 Q2535* probably null Het
Brpf3 T C 17: 28,836,691 *1205R probably null Het
Cabyr C A 18: 12,751,758 P434Q probably damaging Het
Cacna1g C A 11: 94,409,231 D2268Y possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cct4 A G 11: 22,997,111 T201A probably benign Het
Cdyl2 A C 8: 116,623,994 S133A probably benign Het
Cep76 A G 18: 67,641,134 L14P possibly damaging Het
Col4a3bp T A 13: 96,630,833 probably null Het
Crybg3 A T 16: 59,559,593 S433T possibly damaging Het
Cul9 T C 17: 46,538,497 K574R probably damaging Het
Cyp2u1 T C 3: 131,291,143 I527V probably benign Het
E130309D02Rik A G 5: 143,307,843 V293A probably benign Het
F5 A G 1: 164,219,397 N2142S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Flnc A G 6: 29,450,871 Y1506C probably damaging Het
Foxred2 T A 15: 77,952,030 S376C probably damaging Het
Gbe1 T C 16: 70,495,370 L530P probably damaging Het
Gm8994 A T 6: 136,329,215 I225F probably damaging Het
Hmcn1 T C 1: 150,649,580 R3398G probably null Het
Igf1r T C 7: 68,187,157 L587P probably damaging Het
Kcna3 T C 3: 107,036,537 Y39H probably benign Het
Krtap5-2 GCCACAGCCTCCCTTGCAACCCCCACAGGAGCCACAGCCCCCACAGGAACTACAGCCTCCCTTGCA GCTACAGCCTCCCTTGCA 7: 142,175,243 probably benign Het
Mbl1 T C 14: 41,158,712 F186L probably damaging Het
Ncam2 A T 16: 81,589,795 K687N probably damaging Het
Nedd4l T C 18: 64,997,370 V24A probably damaging Het
Nek1 A G 8: 61,073,578 E661G probably damaging Het
Nudt14 G T 12: 112,939,320 D28E probably benign Het
Olfr1297 A T 2: 111,621,255 V273E probably damaging Het
Olfr134 T A 17: 38,175,096 I4N probably benign Het
Olfr344 T A 2: 36,569,236 C213S probably benign Het
Olfr702 T C 7: 106,824,591 probably benign Het
Pdk4 A T 6: 5,487,089 M319K probably benign Het
Pfkp T C 13: 6,593,216 N522S probably benign Het
Pias2 T C 18: 77,120,121 V234A possibly damaging Het
Pik3c2b C A 1: 133,079,774 H625Q probably benign Het
Pnpla7 T C 2: 25,051,615 S1117P probably damaging Het
Prdm2 A T 4: 143,180,894 V36D probably damaging Het
Prep C T 10: 45,092,699 R98C probably benign Het
Rae1 T C 2: 173,008,317 probably null Het
Rgs3 T A 4: 62,615,336 V138E probably damaging Het
Rnf185 T C 11: 3,425,329 T142A possibly damaging Het
Rsph6a C A 7: 19,065,647 P401Q probably damaging Het
Runx3 A T 4: 135,121,145 T14S probably benign Het
Scaf11 A G 15: 96,419,161 S841P probably damaging Het
Spta1 T A 1: 174,184,612 L328Q probably damaging Het
Sqor G A 2: 122,804,009 V318M probably damaging Het
Stox2 T C 8: 47,186,454 T902A probably benign Het
Susd3 T C 13: 49,231,203 H248R probably damaging Het
Syne1 T C 10: 5,233,406 Y4133C probably damaging Het
Tbc1d20 C T 2: 152,311,417 T289M probably benign Het
Unc80 T A 1: 66,549,784 F1036Y possibly damaging Het
Zbtb7c T C 18: 76,137,938 C366R probably damaging Het
Zfp606 T G 7: 12,494,039 S696A probably benign Het
Other mutations in Zeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zeb1 APN 18 5767774 missense probably benign 0.00
IGL01139:Zeb1 APN 18 5705061 missense possibly damaging 0.69
IGL01444:Zeb1 APN 18 5767906 missense probably damaging 1.00
IGL01444:Zeb1 APN 18 5767138 missense probably benign
IGL01806:Zeb1 APN 18 5767867 missense possibly damaging 0.94
IGL01988:Zeb1 APN 18 5759037 nonsense probably null
IGL02059:Zeb1 APN 18 5766892 missense probably damaging 1.00
IGL03005:Zeb1 APN 18 5767150 missense probably benign 0.03
IGL03153:Zeb1 APN 18 5770511 missense probably damaging 1.00
cellophane UTSW 18 5770554 nonsense probably null
serpens UTSW 18 5772455 missense probably damaging 1.00
N/A - 293:Zeb1 UTSW 18 5767076 missense possibly damaging 0.68
R0184:Zeb1 UTSW 18 5766808 missense probably damaging 1.00
R0488:Zeb1 UTSW 18 5772455 missense probably damaging 1.00
R0622:Zeb1 UTSW 18 5759123 nonsense probably null
R0646:Zeb1 UTSW 18 5759027 missense probably damaging 1.00
R0881:Zeb1 UTSW 18 5767138 missense probably benign
R1251:Zeb1 UTSW 18 5705089 missense probably damaging 1.00
R1257:Zeb1 UTSW 18 5772699 missense possibly damaging 0.53
R1501:Zeb1 UTSW 18 5761399 missense possibly damaging 0.95
R1547:Zeb1 UTSW 18 5767450 missense possibly damaging 0.50
R1797:Zeb1 UTSW 18 5766298 nonsense probably null
R1815:Zeb1 UTSW 18 5767898 missense probably damaging 1.00
R2090:Zeb1 UTSW 18 5766458 missense possibly damaging 0.65
R2129:Zeb1 UTSW 18 5767681 missense possibly damaging 0.92
R2875:Zeb1 UTSW 18 5772859 small insertion probably benign
R3888:Zeb1 UTSW 18 5748743 missense probably damaging 1.00
R3941:Zeb1 UTSW 18 5767799 missense probably benign 0.06
R3952:Zeb1 UTSW 18 5772716 missense probably benign 0.17
R4271:Zeb1 UTSW 18 5758985 missense probably damaging 0.99
R4512:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4514:Zeb1 UTSW 18 5759007 missense probably damaging 1.00
R4677:Zeb1 UTSW 18 5766775 missense probably damaging 0.97
R4729:Zeb1 UTSW 18 5767286 missense probably damaging 1.00
R5839:Zeb1 UTSW 18 5767507 missense probably benign
R5913:Zeb1 UTSW 18 5766765 missense possibly damaging 0.49
R6248:Zeb1 UTSW 18 5766962 missense probably damaging 1.00
R6354:Zeb1 UTSW 18 5772743 missense possibly damaging 0.64
R6429:Zeb1 UTSW 18 5770498 missense probably damaging 1.00
R6819:Zeb1 UTSW 18 5591917 missense probably damaging 1.00
R7180:Zeb1 UTSW 18 5767867 missense possibly damaging 0.94
R7199:Zeb1 UTSW 18 5767703 missense probably benign 0.00
R7397:Zeb1 UTSW 18 5761394 missense probably damaging 1.00
R7534:Zeb1 UTSW 18 5766611 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTGGCAAGCGCTTCTC -3'
(R):5'- TGTACCATCAGTCTTGGCTGC -3'

Sequencing Primer
(F):5'- GGCAAGCGCTTCTCACACTC -3'
(R):5'- TGCTGCCTCATGCTCGG -3'
Posted On2019-06-26