Incidental Mutation 'R7194:Cfi'
ID559769
Institutional Source Beutler Lab
Gene Symbol Cfi
Ensembl Gene ENSMUSG00000058952
Gene Namecomplement component factor i
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7194 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location129835884-129875332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129855059 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 197 (S197R)
Ref Sequence ENSEMBL: ENSMUSP00000077074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]
Predicted Effect probably damaging
Transcript: ENSMUST00000077918
AA Change: S197R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: S197R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 4.63e-38 SMART
KAZAL 63 109 6.91e-3 SMART
SR 117 220 2.95e-22 SMART
LDLa 225 262 1.07e-4 SMART
LDLa 263 300 7.16e-6 SMART
low complexity region 317 326 N/A INTRINSIC
Tryp_SPc 360 589 3.33e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200206
SMART Domains Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 2.2e-40 SMART
KAZAL 63 109 4.4e-5 SMART
Blast:SR 117 145 3e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,164,775 E429D probably benign Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Abi3bp C T 16: 56,562,371 R115C probably damaging Het
Adam18 A G 8: 24,651,852 S234P possibly damaging Het
Adam20 A G 8: 40,796,412 R520G probably benign Het
Angel2 C G 1: 190,944,997 T514R probably damaging Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Ankrd7 A T 6: 18,879,343 Y262F probably benign Het
Ano8 C A 8: 71,482,363 L398F possibly damaging Het
App C T 16: 85,025,431 V356I probably benign Het
Atp1a2 C A 1: 172,280,627 E636* probably null Het
Cckbr G A 7: 105,435,345 E429K possibly damaging Het
Chn2 A G 6: 54,286,177 probably null Het
Col3a1 C A 1: 45,331,700 A405D unknown Het
Colec12 A T 18: 9,848,248 N142I probably benign Het
Copa T C 1: 172,119,944 L1109P probably damaging Het
Cpeb3 T A 19: 37,174,752 M75L probably benign Het
Cyp2d11 T C 15: 82,391,768 Y204C probably benign Het
Defa17 A G 8: 21,656,597 T80A probably benign Het
Dppa5a C T 9: 78,367,720 probably null Het
Fat4 G T 3: 38,888,884 S642I probably damaging Het
Fat4 T A 3: 38,983,895 C3899S probably damaging Het
Fn1 A G 1: 71,602,323 V1869A probably damaging Het
Gm10308 A T 17: 91,088,961 I104L unknown Het
Gm15448 A G 7: 3,824,793 W122R Het
Gpr139 C T 7: 119,144,673 A230T possibly damaging Het
Grm8 T C 6: 27,618,487 N452S probably benign Het
Hmox1 T C 8: 75,096,923 V73A probably benign Het
Hspa4 A G 11: 53,265,938 F641L probably damaging Het
Ifi207 T G 1: 173,729,924 H416P possibly damaging Het
Igkv10-96 G T 6: 68,632,044 T89K possibly damaging Het
Kmt2d A C 15: 98,843,833 V4482G unknown Het
Krt28 T A 11: 99,374,404 K146* probably null Het
Krt82 T C 15: 101,542,756 N406S probably damaging Het
Marveld3 A T 8: 109,959,845 probably null Het
Mllt6 C T 11: 97,673,568 S370L probably benign Het
Muc16 A G 9: 18,674,454 L26S unknown Het
Mup12 T A 4: 60,740,735 E48V probably benign Het
Myh1 G A 11: 67,211,357 V825I probably benign Het
Nipal3 G A 4: 135,474,421 T152I probably benign Het
Nrg3 A T 14: 39,472,478 M108K probably benign Het
Olfr961 G A 9: 39,647,091 V122I probably benign Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pkhd1l1 T C 15: 44,529,116 C1616R probably damaging Het
Ppa2 T A 3: 133,348,192 probably null Het
Ppfibp2 T A 7: 107,722,980 probably null Het
Ppp4c T C 7: 126,786,481 N229D probably damaging Het
Ptpn9 T C 9: 57,022,286 F96L probably damaging Het
Pygl A G 12: 70,194,320 V742A probably benign Het
Ranbp2 A G 10: 58,476,769 T1104A probably benign Het
Rasal1 G A 5: 120,675,492 A644T probably benign Het
Rcor3 T A 1: 192,125,961 T139S possibly damaging Het
Rfx5 T A 3: 94,955,143 I37N probably damaging Het
Rnf112 C T 11: 61,450,857 G374R probably damaging Het
Rrp12 T C 19: 41,871,540 I1034V probably benign Het
Sacs T A 14: 61,210,089 Y3195N possibly damaging Het
Scn4a A G 11: 106,324,236 I1243T probably benign Het
Sirt7 A T 11: 120,618,973 C362S probably benign Het
Slc17a6 T A 7: 51,626,892 S130T probably damaging Het
Snrnp48 A C 13: 38,209,899 Y60S probably damaging Het
Syne1 T C 10: 5,110,859 E7260G probably damaging Het
Trbv15 C T 6: 41,141,595 T95I probably benign Het
Trip12 A T 1: 84,794,222 N68K probably benign Het
Ugcg A G 4: 59,213,210 Y132C probably damaging Het
Usp9y A T Y: 1,304,672 C2391S probably damaging Het
Vmn1r103 C A 7: 20,510,513 V8L probably benign Het
Vmn2r15 T A 5: 109,292,783 N403I probably damaging Het
Zbtb11 T C 16: 56,007,188 S1006P probably damaging Het
Other mutations in Cfi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cfi APN 3 129873095 missense probably damaging 0.97
IGL00659:Cfi APN 3 129836813 missense unknown
IGL01310:Cfi APN 3 129858431 missense probably damaging 1.00
IGL01387:Cfi APN 3 129874913 unclassified probably benign
IGL01897:Cfi APN 3 129858385 missense probably damaging 1.00
IGL02418:Cfi APN 3 129848812 missense probably benign 0.20
F5770:Cfi UTSW 3 129854992 missense possibly damaging 0.62
R0085:Cfi UTSW 3 129874986 missense probably benign 0.00
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0835:Cfi UTSW 3 129868542 missense probably damaging 1.00
R1191:Cfi UTSW 3 129868527 missense probably benign 0.01
R1221:Cfi UTSW 3 129872969 missense probably damaging 0.99
R1576:Cfi UTSW 3 129873050 missense probably damaging 0.98
R1809:Cfi UTSW 3 129873119 critical splice donor site probably null
R1940:Cfi UTSW 3 129858828 splice site probably benign
R1983:Cfi UTSW 3 129868545 missense probably damaging 1.00
R2069:Cfi UTSW 3 129858804 splice site probably null
R3012:Cfi UTSW 3 129874930 missense probably damaging 1.00
R4334:Cfi UTSW 3 129850829 missense possibly damaging 0.80
R4596:Cfi UTSW 3 129868500 missense probably damaging 0.98
R4888:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5121:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5322:Cfi UTSW 3 129873040 missense probably damaging 1.00
R5673:Cfi UTSW 3 129855009 missense probably benign 0.02
R6084:Cfi UTSW 3 129858370 missense probably benign 0.00
R6364:Cfi UTSW 3 129872846 missense probably benign 0.36
R6770:Cfi UTSW 3 129858730 missense probably benign 0.21
R7000:Cfi UTSW 3 129872873 missense probably damaging 1.00
R7108:Cfi UTSW 3 129875016 missense probably damaging 1.00
R7342:Cfi UTSW 3 129875132 missense probably damaging 1.00
R7470:Cfi UTSW 3 129855087 missense probably benign 0.01
R7538:Cfi UTSW 3 129858815 missense probably benign 0.08
R7908:Cfi UTSW 3 129848584 missense probably benign 0.01
R7954:Cfi UTSW 3 129868585 critical splice donor site probably null
R8017:Cfi UTSW 3 129855099 missense probably benign 0.00
R8135:Cfi UTSW 3 129855000 missense probably benign 0.00
R8155:Cfi UTSW 3 129855090 missense probably benign 0.00
R8217:Cfi UTSW 3 129855001 missense possibly damaging 0.61
R8530:Cfi UTSW 3 129850733 missense possibly damaging 0.79
V7580:Cfi UTSW 3 129854992 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTTCTACAGTCTCTAAATCATTTGGGG -3'
(R):5'- AACTTAGCAGGGGCATCACTG -3'

Sequencing Primer
(F):5'- GGAAAGTTTTTCTGTAGAGCCTTAC -3'
(R):5'- AGGGGCATCACTGTCTCCTTG -3'
Posted On2019-06-26