Incidental Mutation 'R0591:Hikeshi'
ID55979
Institutional Source Beutler Lab
Gene Symbol Hikeshi
Ensembl Gene ENSMUSG00000062797
Gene Nameheat shock protein nuclear import factor
Synonyms0610007P06Rik, Hikeshi, l(7)6Rn, 1110002N09Rik, l7Rn6
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0591 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location89917529-89941204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89920087 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 76 (N76K)
Ref Sequence ENSEMBL: ENSMUSP00000112750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075010] [ENSMUST00000078918] [ENSMUST00000117354] [ENSMUST00000130609] [ENSMUST00000153470] [ENSMUST00000207309]
Predicted Effect probably benign
Transcript: ENSMUST00000075010
AA Change: N136K

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102856
Gene: ENSMUSG00000062797
AA Change: N136K

DomainStartEndE-ValueType
Pfam:DUF775 1 156 5.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078918
SMART Domains Protein: ENSMUSP00000077951
Gene: ENSMUSG00000062797

DomainStartEndE-ValueType
Pfam:DUF775 1 89 3e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117354
AA Change: N76K

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112750
Gene: ENSMUSG00000062797
AA Change: N76K

DomainStartEndE-ValueType
Pfam:DUF775 2 96 9.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130609
Predicted Effect unknown
Transcript: ENSMUST00000150740
AA Change: N85K
Predicted Effect probably benign
Transcript: ENSMUST00000153470
AA Change: N175K

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119806
Gene: ENSMUSG00000062797
AA Change: N175K

DomainStartEndE-ValueType
Pfam:DUF775 1 195 2.3e-59 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000207309
AA Change: C125S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208357
Meta Mutation Damage Score 0.1062 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved nuclear transport receptor that mediates heat-shock-induced nuclear import of 70 kDa heat-shock proteins (Hsp70s) through interactions with FG-nucleoporins. The protein mediates transport of the ATP form but not the ADP form of Hsp70 proteins under conditions of heat shock stress. Structural analyses demonstrate that the protein forms an asymmetric homodimer and that the N-terminal domain consists of a jelly-roll/beta-sandwich fold structure that contains hydrophobic pockets involved in FG-nucleoporin recognition. Reduction of RNA expression levels in HeLa cells using small interfering RNAs results in inhibition of heat shock-induced nuclear accumulation of Hsp70s, indicating a role for this gene in regulation of Hsp70 nuclear import during heat shock stress. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for an ENU-induced mutation die prenatally or neonatally, and exhibit cyanoisis with a significant emphysematous phenotype at birth. The secretory apparatus in Clara cells is also affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Hikeshi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Hikeshi APN 7 89935781 missense probably damaging 0.99
IGL00502:Hikeshi APN 7 89923610 missense probably benign 0.34
IGL02296:Hikeshi APN 7 89935922 missense probably damaging 1.00
IGL02749:Hikeshi APN 7 89935889 missense possibly damaging 0.47
IGL03110:Hikeshi APN 7 89935826 missense probably damaging 1.00
R0023:Hikeshi UTSW 7 89920204 splice site probably benign
R1119:Hikeshi UTSW 7 89935730 missense probably benign 0.04
R4646:Hikeshi UTSW 7 89923646 missense probably damaging 1.00
R6799:Hikeshi UTSW 7 89930345 intron probably benign
R7694:Hikeshi UTSW 7 89930346 nonsense probably null
R7698:Hikeshi UTSW 7 89923681 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTGCGAACCACGAGATGCC -3'
(R):5'- cacctgcctGTCTTAGAACGTATATTCC -3'

Sequencing Primer
(F):5'- gagccagaagaggacatcag -3'
(R):5'- GTTCACACAGAAGATGTTGGACAA -3'
Posted On2013-07-11