Incidental Mutation 'R7194:Olfr961'
ID559797
Institutional Source Beutler Lab
Gene Symbol Olfr961
Ensembl Gene ENSMUSG00000059106
Gene Nameolfactory receptor 961
SynonymsMOR224-5, GA_x6K02T2PVTD-33343617-33344561
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R7194 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39645085-39649556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39647091 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 122 (V122I)
Ref Sequence ENSEMBL: ENSMUSP00000151840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076548] [ENSMUST00000219295]
Predicted Effect probably benign
Transcript: ENSMUST00000076548
AA Change: V122I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075863
Gene: ENSMUSG00000059106
AA Change: V122I

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.1e-50 PFAM
Pfam:7tm_1 39 286 4.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219295
AA Change: V122I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,164,775 E429D probably benign Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Abi3bp C T 16: 56,562,371 R115C probably damaging Het
Adam18 A G 8: 24,651,852 S234P possibly damaging Het
Adam20 A G 8: 40,796,412 R520G probably benign Het
Angel2 C G 1: 190,944,997 T514R probably damaging Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Ankrd7 A T 6: 18,879,343 Y262F probably benign Het
Ano8 C A 8: 71,482,363 L398F possibly damaging Het
App C T 16: 85,025,431 V356I probably benign Het
Atp1a2 C A 1: 172,280,627 E636* probably null Het
Cckbr G A 7: 105,435,345 E429K possibly damaging Het
Cfi T G 3: 129,855,059 S197R probably damaging Het
Chn2 A G 6: 54,286,177 probably null Het
Col3a1 C A 1: 45,331,700 A405D unknown Het
Colec12 A T 18: 9,848,248 N142I probably benign Het
Copa T C 1: 172,119,944 L1109P probably damaging Het
Cpeb3 T A 19: 37,174,752 M75L probably benign Het
Cyp2d11 T C 15: 82,391,768 Y204C probably benign Het
Defa17 A G 8: 21,656,597 T80A probably benign Het
Dppa5a C T 9: 78,367,720 probably null Het
Fat4 G T 3: 38,888,884 S642I probably damaging Het
Fat4 T A 3: 38,983,895 C3899S probably damaging Het
Fn1 A G 1: 71,602,323 V1869A probably damaging Het
Gm10308 A T 17: 91,088,961 I104L unknown Het
Gm15448 A G 7: 3,824,793 W122R Het
Gpr139 C T 7: 119,144,673 A230T possibly damaging Het
Grm8 T C 6: 27,618,487 N452S probably benign Het
Hmox1 T C 8: 75,096,923 V73A probably benign Het
Hspa4 A G 11: 53,265,938 F641L probably damaging Het
Ifi207 T G 1: 173,729,924 H416P possibly damaging Het
Igkv10-96 G T 6: 68,632,044 T89K possibly damaging Het
Kmt2d A C 15: 98,843,833 V4482G unknown Het
Krt28 T A 11: 99,374,404 K146* probably null Het
Krt82 T C 15: 101,542,756 N406S probably damaging Het
Marveld3 A T 8: 109,959,845 probably null Het
Mllt6 C T 11: 97,673,568 S370L probably benign Het
Muc16 A G 9: 18,674,454 L26S unknown Het
Mup12 T A 4: 60,740,735 E48V probably benign Het
Myh1 G A 11: 67,211,357 V825I probably benign Het
Nipal3 G A 4: 135,474,421 T152I probably benign Het
Nrg3 A T 14: 39,472,478 M108K probably benign Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pkhd1l1 T C 15: 44,529,116 C1616R probably damaging Het
Ppa2 T A 3: 133,348,192 probably null Het
Ppfibp2 T A 7: 107,722,980 probably null Het
Ppp4c T C 7: 126,786,481 N229D probably damaging Het
Ptpn9 T C 9: 57,022,286 F96L probably damaging Het
Pygl A G 12: 70,194,320 V742A probably benign Het
Ranbp2 A G 10: 58,476,769 T1104A probably benign Het
Rasal1 G A 5: 120,675,492 A644T probably benign Het
Rcor3 T A 1: 192,125,961 T139S possibly damaging Het
Rfx5 T A 3: 94,955,143 I37N probably damaging Het
Rnf112 C T 11: 61,450,857 G374R probably damaging Het
Rrp12 T C 19: 41,871,540 I1034V probably benign Het
Sacs T A 14: 61,210,089 Y3195N possibly damaging Het
Scn4a A G 11: 106,324,236 I1243T probably benign Het
Sirt7 A T 11: 120,618,973 C362S probably benign Het
Slc17a6 T A 7: 51,626,892 S130T probably damaging Het
Snrnp48 A C 13: 38,209,899 Y60S probably damaging Het
Syne1 T C 10: 5,110,859 E7260G probably damaging Het
Trbv15 C T 6: 41,141,595 T95I probably benign Het
Trip12 A T 1: 84,794,222 N68K probably benign Het
Ugcg A G 4: 59,213,210 Y132C probably damaging Het
Usp9y A T Y: 1,304,672 C2391S probably damaging Het
Vmn1r103 C A 7: 20,510,513 V8L probably benign Het
Vmn2r15 T A 5: 109,292,783 N403I probably damaging Het
Zbtb11 T C 16: 56,007,188 S1006P probably damaging Het
Other mutations in Olfr961
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr961 APN 9 39647340 missense probably benign 0.19
IGL01792:Olfr961 APN 9 39647659 missense probably benign 0.07
R0344:Olfr961 UTSW 9 39647350 missense probably damaging 1.00
R0503:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R0525:Olfr961 UTSW 9 39647471 missense probably damaging 1.00
R0531:Olfr961 UTSW 9 39646872 missense probably benign
R1188:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R1453:Olfr961 UTSW 9 39647163 missense probably benign 0.01
R2970:Olfr961 UTSW 9 39646899 missense probably damaging 1.00
R3883:Olfr961 UTSW 9 39647124 missense probably benign 0.07
R4423:Olfr961 UTSW 9 39647116 missense probably damaging 1.00
R5129:Olfr961 UTSW 9 39647494 missense probably benign 0.03
R6148:Olfr961 UTSW 9 39647259 missense probably damaging 1.00
R6738:Olfr961 UTSW 9 39646661 start gained probably benign
R6778:Olfr961 UTSW 9 39646747 missense probably damaging 1.00
R7545:Olfr961 UTSW 9 39647107 missense probably damaging 0.97
RF008:Olfr961 UTSW 9 39647263 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AATGTATGCCTGTGCCCTGC -3'
(R):5'- TGCAGGCATGTCACAGAAG -3'

Sequencing Primer
(F):5'- ACCCATGTACTTTTTCTTGGGAAAC -3'
(R):5'- GTAATAACTCACCTCACTGGGG -3'
Posted On2019-06-26