Incidental Mutation 'R7194:Pygl'
ID559809
Institutional Source Beutler Lab
Gene Symbol Pygl
Ensembl Gene ENSMUSG00000021069
Gene Nameliver glycogen phosphorylase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R7194 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location70190811-70231488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70194320 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 742 (V742A)
Ref Sequence ENSEMBL: ENSMUSP00000071231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]
Predicted Effect probably benign
Transcript: ENSMUST00000071250
AA Change: V742A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: V742A

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161083
AA Change: V651A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: V651A

DomainStartEndE-ValueType
Pfam:Phosphorylase 21 739 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,164,775 E429D probably benign Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Abi3bp C T 16: 56,562,371 R115C probably damaging Het
Adam18 A G 8: 24,651,852 S234P possibly damaging Het
Adam20 A G 8: 40,796,412 R520G probably benign Het
Angel2 C G 1: 190,944,997 T514R probably damaging Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Ankrd7 A T 6: 18,879,343 Y262F probably benign Het
Ano8 C A 8: 71,482,363 L398F possibly damaging Het
App C T 16: 85,025,431 V356I probably benign Het
Atp1a2 C A 1: 172,280,627 E636* probably null Het
Cckbr G A 7: 105,435,345 E429K possibly damaging Het
Cfi T G 3: 129,855,059 S197R probably damaging Het
Chn2 A G 6: 54,286,177 probably null Het
Col3a1 C A 1: 45,331,700 A405D unknown Het
Colec12 A T 18: 9,848,248 N142I probably benign Het
Copa T C 1: 172,119,944 L1109P probably damaging Het
Cpeb3 T A 19: 37,174,752 M75L probably benign Het
Cyp2d11 T C 15: 82,391,768 Y204C probably benign Het
Defa17 A G 8: 21,656,597 T80A probably benign Het
Dppa5a C T 9: 78,367,720 probably null Het
Fat4 G T 3: 38,888,884 S642I probably damaging Het
Fat4 T A 3: 38,983,895 C3899S probably damaging Het
Fn1 A G 1: 71,602,323 V1869A probably damaging Het
Gm10308 A T 17: 91,088,961 I104L unknown Het
Gm15448 A G 7: 3,824,793 W122R Het
Gpr139 C T 7: 119,144,673 A230T possibly damaging Het
Grm8 T C 6: 27,618,487 N452S probably benign Het
Hmox1 T C 8: 75,096,923 V73A probably benign Het
Hspa4 A G 11: 53,265,938 F641L probably damaging Het
Ifi207 T G 1: 173,729,924 H416P possibly damaging Het
Igkv10-96 G T 6: 68,632,044 T89K possibly damaging Het
Kmt2d A C 15: 98,843,833 V4482G unknown Het
Krt28 T A 11: 99,374,404 K146* probably null Het
Krt82 T C 15: 101,542,756 N406S probably damaging Het
Marveld3 A T 8: 109,959,845 probably null Het
Mllt6 C T 11: 97,673,568 S370L probably benign Het
Muc16 A G 9: 18,674,454 L26S unknown Het
Mup12 T A 4: 60,740,735 E48V probably benign Het
Myh1 G A 11: 67,211,357 V825I probably benign Het
Nipal3 G A 4: 135,474,421 T152I probably benign Het
Nrg3 A T 14: 39,472,478 M108K probably benign Het
Olfr961 G A 9: 39,647,091 V122I probably benign Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pkhd1l1 T C 15: 44,529,116 C1616R probably damaging Het
Ppa2 T A 3: 133,348,192 probably null Het
Ppfibp2 T A 7: 107,722,980 probably null Het
Ppp4c T C 7: 126,786,481 N229D probably damaging Het
Ptpn9 T C 9: 57,022,286 F96L probably damaging Het
Ranbp2 A G 10: 58,476,769 T1104A probably benign Het
Rasal1 G A 5: 120,675,492 A644T probably benign Het
Rcor3 T A 1: 192,125,961 T139S possibly damaging Het
Rfx5 T A 3: 94,955,143 I37N probably damaging Het
Rnf112 C T 11: 61,450,857 G374R probably damaging Het
Rrp12 T C 19: 41,871,540 I1034V probably benign Het
Sacs T A 14: 61,210,089 Y3195N possibly damaging Het
Scn4a A G 11: 106,324,236 I1243T probably benign Het
Sirt7 A T 11: 120,618,973 C362S probably benign Het
Slc17a6 T A 7: 51,626,892 S130T probably damaging Het
Snrnp48 A C 13: 38,209,899 Y60S probably damaging Het
Syne1 T C 10: 5,110,859 E7260G probably damaging Het
Trbv15 C T 6: 41,141,595 T95I probably benign Het
Trip12 A T 1: 84,794,222 N68K probably benign Het
Ugcg A G 4: 59,213,210 Y132C probably damaging Het
Usp9y A T Y: 1,304,672 C2391S probably damaging Het
Vmn1r103 C A 7: 20,510,513 V8L probably benign Het
Vmn2r15 T A 5: 109,292,783 N403I probably damaging Het
Zbtb11 T C 16: 56,007,188 S1006P probably damaging Het
Other mutations in Pygl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pygl APN 12 70191092 missense probably damaging 1.00
IGL00903:Pygl APN 12 70207742 missense probably damaging 1.00
IGL01965:Pygl APN 12 70191114 missense probably benign 0.00
IGL02347:Pygl APN 12 70201892 missense probably benign 0.14
IGL02403:Pygl APN 12 70194258 missense probably benign
IGL02501:Pygl APN 12 70191134 missense probably benign 0.05
IGL02727:Pygl APN 12 70207668 splice site probably null
IGL03125:Pygl APN 12 70197482 missense probably damaging 1.00
IGL03158:Pygl APN 12 70195675 missense probably damaging 1.00
IGL03202:Pygl APN 12 70199646 missense probably benign
IGL03368:Pygl APN 12 70191152 missense probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0524:Pygl UTSW 12 70207724 missense probably damaging 1.00
R0883:Pygl UTSW 12 70206404 missense probably damaging 0.97
R0894:Pygl UTSW 12 70194374 splice site probably benign
R0905:Pygl UTSW 12 70211017 splice site probably benign
R1494:Pygl UTSW 12 70199730 missense probably damaging 0.98
R1621:Pygl UTSW 12 70191092 missense probably damaging 1.00
R1647:Pygl UTSW 12 70197010 missense possibly damaging 0.60
R3082:Pygl UTSW 12 70197529 missense probably damaging 1.00
R3845:Pygl UTSW 12 70198443 missense probably benign 0.12
R3876:Pygl UTSW 12 70201339 missense probably damaging 1.00
R4358:Pygl UTSW 12 70195690 missense probably damaging 1.00
R4614:Pygl UTSW 12 70210979 splice site probably null
R4707:Pygl UTSW 12 70207758 missense possibly damaging 0.69
R4908:Pygl UTSW 12 70197033 missense probably null
R4940:Pygl UTSW 12 70206381 missense probably damaging 1.00
R5077:Pygl UTSW 12 70201892 missense probably benign 0.14
R5186:Pygl UTSW 12 70201344 missense probably damaging 1.00
R5726:Pygl UTSW 12 70191142 nonsense probably null
R5953:Pygl UTSW 12 70219627 missense probably damaging 1.00
R5957:Pygl UTSW 12 70199720 missense probably damaging 0.99
R6020:Pygl UTSW 12 70216654 missense probably damaging 1.00
R6024:Pygl UTSW 12 70197067 missense probably benign 0.09
R7050:Pygl UTSW 12 70219622 missense probably damaging 1.00
R7159:Pygl UTSW 12 70197406 missense probably benign 0.41
R7283:Pygl UTSW 12 70216568 missense possibly damaging 0.92
R7360:Pygl UTSW 12 70227532 missense probably benign 0.11
R7446:Pygl UTSW 12 70197010 missense probably benign
R7637:Pygl UTSW 12 70197795 splice site probably null
R7886:Pygl UTSW 12 70206356 splice site probably null
R8054:Pygl UTSW 12 70227339 critical splice donor site probably null
Z1176:Pygl UTSW 12 70222874 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCGCTAAGTTACCTGAGTGG -3'
(R):5'- TGCTGCTTAAACCATAATCGGC -3'

Sequencing Primer
(F):5'- CTAAGTTACCTGAGTGGGTTGC -3'
(R):5'- ACTGACACGGCCTTTTC -3'
Posted On2019-06-26