Incidental Mutation 'R0591:Agt'
ID55981
Institutional Source Beutler Lab
Gene Symbol Agt
Ensembl Gene ENSMUSG00000031980
Gene Nameangiotensinogen (serpin peptidase inhibitor, clade A, member 8)
SynonymsAogen, angiotensin precursor, Serpina8
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R0591 (G1)
Quality Score152
Status Validated
Chromosome8
Chromosomal Location124556534-124569706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124556939 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 480 (S480R)
Ref Sequence ENSEMBL: ENSMUSP00000066488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000063278]
Predicted Effect probably benign
Transcript: ENSMUST00000034460
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000063278
AA Change: S480R

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066488
Gene: ENSMUSG00000031980
AA Change: S480R

DomainStartEndE-ValueType
SERPIN 111 478 6.63e-57 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this gene results in small body size and lower body fat, decreased blood pressure and hypotension, kidney abnormalities, polydipsia and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Agt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Agt APN 8 124557895 splice site probably benign
IGL01648:Agt APN 8 124564406 missense probably benign 0.01
IGL02145:Agt APN 8 124564448 missense probably damaging 0.99
IGL02929:Agt APN 8 124557090 missense probably benign
IGL02978:Agt APN 8 124557763 missense possibly damaging 0.93
IGL03207:Agt APN 8 124559368 missense probably damaging 0.98
R0518:Agt UTSW 8 124557100 nonsense probably null
R0521:Agt UTSW 8 124557100 nonsense probably null
R0562:Agt UTSW 8 124559275 missense probably benign 0.00
R0646:Agt UTSW 8 124557113 missense probably damaging 1.00
R1495:Agt UTSW 8 124559455 missense probably damaging 1.00
R2568:Agt UTSW 8 124556955 missense probably damaging 1.00
R4750:Agt UTSW 8 124556937 missense probably benign
R4941:Agt UTSW 8 124556988 missense probably benign 0.32
R5782:Agt UTSW 8 124557131 splice site probably null
R5916:Agt UTSW 8 124563858 missense possibly damaging 0.70
R6332:Agt UTSW 8 124557833 missense possibly damaging 0.92
X0067:Agt UTSW 8 124556955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTCCAGAGTGGCAGTCCTGTG -3'
(R):5'- GCAGGTTCTCAATAGCATCCTCCTC -3'

Sequencing Primer
(F):5'- TGTGCAGAGTGCCAGCTTC -3'
(R):5'- TCCTCGAACTCAAAGCAGGAG -3'
Posted On2013-07-11