Incidental Mutation 'R7194:Cyp2d11'
ID559815
Institutional Source Beutler Lab
Gene Symbol Cyp2d11
Ensembl Gene ENSMUSG00000068085
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 11
SynonymsCyp2d, P450-2D
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R7194 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82389154-82394022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82391768 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 204 (Y204C)
Ref Sequence ENSEMBL: ENSMUSP00000130338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170255]
Predicted Effect probably benign
Transcript: ENSMUST00000170255
AA Change: Y204C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130338
Gene: ENSMUSG00000068085
AA Change: Y204C

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 7.7e-140 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,164,775 E429D probably benign Het
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Abi3bp C T 16: 56,562,371 R115C probably damaging Het
Adam18 A G 8: 24,651,852 S234P possibly damaging Het
Adam20 A G 8: 40,796,412 R520G probably benign Het
Angel2 C G 1: 190,944,997 T514R probably damaging Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Ankrd7 A T 6: 18,879,343 Y262F probably benign Het
Ano8 C A 8: 71,482,363 L398F possibly damaging Het
App C T 16: 85,025,431 V356I probably benign Het
Atp1a2 C A 1: 172,280,627 E636* probably null Het
Cckbr G A 7: 105,435,345 E429K possibly damaging Het
Cfi T G 3: 129,855,059 S197R probably damaging Het
Chn2 A G 6: 54,286,177 probably null Het
Col3a1 C A 1: 45,331,700 A405D unknown Het
Colec12 A T 18: 9,848,248 N142I probably benign Het
Copa T C 1: 172,119,944 L1109P probably damaging Het
Cpeb3 T A 19: 37,174,752 M75L probably benign Het
Defa17 A G 8: 21,656,597 T80A probably benign Het
Dppa5a C T 9: 78,367,720 probably null Het
Fat4 G T 3: 38,888,884 S642I probably damaging Het
Fat4 T A 3: 38,983,895 C3899S probably damaging Het
Fn1 A G 1: 71,602,323 V1869A probably damaging Het
Gm10308 A T 17: 91,088,961 I104L unknown Het
Gm15448 A G 7: 3,824,793 W122R Het
Gpr139 C T 7: 119,144,673 A230T possibly damaging Het
Grm8 T C 6: 27,618,487 N452S probably benign Het
Hmox1 T C 8: 75,096,923 V73A probably benign Het
Hspa4 A G 11: 53,265,938 F641L probably damaging Het
Ifi207 T G 1: 173,729,924 H416P possibly damaging Het
Igkv10-96 G T 6: 68,632,044 T89K possibly damaging Het
Kmt2d A C 15: 98,843,833 V4482G unknown Het
Krt28 T A 11: 99,374,404 K146* probably null Het
Krt82 T C 15: 101,542,756 N406S probably damaging Het
Marveld3 A T 8: 109,959,845 probably null Het
Mllt6 C T 11: 97,673,568 S370L probably benign Het
Muc16 A G 9: 18,674,454 L26S unknown Het
Mup12 T A 4: 60,740,735 E48V probably benign Het
Myh1 G A 11: 67,211,357 V825I probably benign Het
Nipal3 G A 4: 135,474,421 T152I probably benign Het
Nrg3 A T 14: 39,472,478 M108K probably benign Het
Olfr961 G A 9: 39,647,091 V122I probably benign Het
Oog3 A T 4: 144,162,599 I3N probably damaging Het
Pkhd1l1 T C 15: 44,529,116 C1616R probably damaging Het
Ppa2 T A 3: 133,348,192 probably null Het
Ppfibp2 T A 7: 107,722,980 probably null Het
Ppp4c T C 7: 126,786,481 N229D probably damaging Het
Ptpn9 T C 9: 57,022,286 F96L probably damaging Het
Pygl A G 12: 70,194,320 V742A probably benign Het
Ranbp2 A G 10: 58,476,769 T1104A probably benign Het
Rasal1 G A 5: 120,675,492 A644T probably benign Het
Rcor3 T A 1: 192,125,961 T139S possibly damaging Het
Rfx5 T A 3: 94,955,143 I37N probably damaging Het
Rnf112 C T 11: 61,450,857 G374R probably damaging Het
Rrp12 T C 19: 41,871,540 I1034V probably benign Het
Sacs T A 14: 61,210,089 Y3195N possibly damaging Het
Scn4a A G 11: 106,324,236 I1243T probably benign Het
Sirt7 A T 11: 120,618,973 C362S probably benign Het
Slc17a6 T A 7: 51,626,892 S130T probably damaging Het
Snrnp48 A C 13: 38,209,899 Y60S probably damaging Het
Syne1 T C 10: 5,110,859 E7260G probably damaging Het
Trbv15 C T 6: 41,141,595 T95I probably benign Het
Trip12 A T 1: 84,794,222 N68K probably benign Het
Ugcg A G 4: 59,213,210 Y132C probably damaging Het
Usp9y A T Y: 1,304,672 C2391S probably damaging Het
Vmn1r103 C A 7: 20,510,513 V8L probably benign Het
Vmn2r15 T A 5: 109,292,783 N403I probably damaging Het
Zbtb11 T C 16: 56,007,188 S1006P probably damaging Het
Other mutations in Cyp2d11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cyp2d11 APN 15 82392468 missense probably benign 0.00
IGL00896:Cyp2d11 APN 15 82391074 splice site probably benign
IGL02119:Cyp2d11 APN 15 82390064 missense probably damaging 0.98
IGL02234:Cyp2d11 APN 15 82390139 missense probably benign
IGL02347:Cyp2d11 APN 15 82390480 missense probably benign 0.22
IGL02352:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02359:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02876:Cyp2d11 APN 15 82389496 missense possibly damaging 0.85
IGL03079:Cyp2d11 APN 15 82390966 missense probably damaging 1.00
IGL03259:Cyp2d11 APN 15 82390020 missense probably damaging 0.99
FR4340:Cyp2d11 UTSW 15 82390022 frame shift probably null
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0101:Cyp2d11 UTSW 15 82390194 splice site probably benign
R0125:Cyp2d11 UTSW 15 82389221 missense probably benign 0.45
R0973:Cyp2d11 UTSW 15 82389529 missense possibly damaging 0.80
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1525:Cyp2d11 UTSW 15 82389297 missense probably damaging 0.98
R1708:Cyp2d11 UTSW 15 82390432 missense probably benign 0.01
R1968:Cyp2d11 UTSW 15 82389548 missense probably benign 0.01
R2117:Cyp2d11 UTSW 15 82391753 missense probably damaging 0.99
R2223:Cyp2d11 UTSW 15 82390131 missense probably benign 0.23
R2405:Cyp2d11 UTSW 15 82389266 missense possibly damaging 0.88
R3745:Cyp2d11 UTSW 15 82391855 missense probably benign 0.31
R4081:Cyp2d11 UTSW 15 82391801 missense possibly damaging 0.86
R4496:Cyp2d11 UTSW 15 82391948 splice site probably benign
R4732:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4733:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4880:Cyp2d11 UTSW 15 82392105 missense probably benign 0.01
R4898:Cyp2d11 UTSW 15 82391023 missense probably benign 0.03
R5045:Cyp2d11 UTSW 15 82391071 critical splice acceptor site probably null
R5328:Cyp2d11 UTSW 15 82391771 missense probably benign 0.04
R5356:Cyp2d11 UTSW 15 82390511 missense probably benign 0.11
R5397:Cyp2d11 UTSW 15 82392078 missense probably damaging 1.00
R5582:Cyp2d11 UTSW 15 82392118 splice site probably null
R6862:Cyp2d11 UTSW 15 82390138 missense probably benign
R8097:Cyp2d11 UTSW 15 82390380 critical splice donor site probably null
R8122:Cyp2d11 UTSW 15 82392543 missense probably benign 0.27
R8152:Cyp2d11 UTSW 15 82392487 missense probably benign
R8194:Cyp2d11 UTSW 15 82390437 missense probably damaging 1.00
R8531:Cyp2d11 UTSW 15 82389228 missense probably benign
Z1088:Cyp2d11 UTSW 15 82390111 missense probably damaging 0.99
Z1177:Cyp2d11 UTSW 15 82392499 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCATATCCTCCTGCAGTTGAC -3'
(R):5'- AGACACCTCTGTGATGCCTTC -3'

Sequencing Primer
(F):5'- TGCAGTTGACCCCCAGAAG -3'
(R):5'- TGATGCCTTCACCGCCCAG -3'
Posted On2019-06-26