Incidental Mutation 'R7195:Map4k4'
ID559826
Institutional Source Beutler Lab
Gene Symbol Map4k4
Ensembl Gene ENSMUSG00000026074
Gene Namemitogen-activated protein kinase kinase kinase kinase 4
Synonyms9430080K19Rik, Nik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location39900913-40026310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40019669 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1008 (Y1008H)
Ref Sequence ENSEMBL: ENSMUSP00000141862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163854] [ENSMUST00000168431] [ENSMUST00000192509] [ENSMUST00000193682] [ENSMUST00000195259] [ENSMUST00000195636] [ENSMUST00000195860]
Predicted Effect probably damaging
Transcript: ENSMUST00000163854
AA Change: Y1075H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126961
Gene: ENSMUSG00000026074
AA Change: Y1075H

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000129796
Gene: ENSMUSG00000026074
AA Change: Y1025H

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192509
AA Change: Y1021H
SMART Domains Protein: ENSMUSP00000141665
Gene: ENSMUSG00000026074
AA Change: Y1021H

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193682
AA Change: Y1008H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141862
Gene: ENSMUSG00000026074
AA Change: Y1008H

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 590 616 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 680 706 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
CNH 903 1201 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195259
AA Change: Y995H
SMART Domains Protein: ENSMUSP00000142056
Gene: ENSMUSG00000026074
AA Change: Y995H

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 811 824 N/A INTRINSIC
low complexity region 839 849 N/A INTRINSIC
CNH 890 1188 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195636
AA Change: Y1059H
SMART Domains Protein: ENSMUSP00000141613
Gene: ENSMUSG00000026074
AA Change: Y1059H

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 836 865 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
CNH 954 1252 1.4e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195860
AA Change: Y1075H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141400
Gene: ENSMUSG00000026074
AA Change: Y1075H

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around day E9.5-10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Map4k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Map4k4 APN 1 40004816 missense probably damaging 0.99
IGL00417:Map4k4 APN 1 40014532 missense possibly damaging 0.92
IGL00516:Map4k4 APN 1 40014602 missense probably damaging 1.00
IGL01545:Map4k4 APN 1 40014229 splice site probably benign
IGL02092:Map4k4 APN 1 39986783 missense probably benign 0.12
IGL02092:Map4k4 APN 1 40024348 missense probably damaging 1.00
IGL02570:Map4k4 APN 1 39980579 missense probably benign 0.06
IGL02626:Map4k4 APN 1 40014097 splice site probably benign
IGL02993:Map4k4 APN 1 40014188 missense probably damaging 0.98
IGL03178:Map4k4 APN 1 39986693 missense possibly damaging 0.63
tank UTSW 1 40004864 missense possibly damaging 0.93
IGL02835:Map4k4 UTSW 1 40010600 missense probably damaging 0.99
R0496:Map4k4 UTSW 1 40006822 missense probably damaging 0.99
R0498:Map4k4 UTSW 1 39990178 missense probably benign 0.22
R0588:Map4k4 UTSW 1 40004864 missense possibly damaging 0.93
R0674:Map4k4 UTSW 1 40003815 missense probably damaging 1.00
R1205:Map4k4 UTSW 1 40003844 missense probably damaging 1.00
R1349:Map4k4 UTSW 1 40021159 missense probably damaging 1.00
R1615:Map4k4 UTSW 1 40006830 splice site probably benign
R1763:Map4k4 UTSW 1 40000757 splice site probably benign
R1800:Map4k4 UTSW 1 40023460 missense probably damaging 1.00
R1893:Map4k4 UTSW 1 40001557 missense probably benign 0.08
R2411:Map4k4 UTSW 1 40007496 missense probably damaging 0.96
R2851:Map4k4 UTSW 1 40000755 splice site probably benign
R2852:Map4k4 UTSW 1 40000755 splice site probably benign
R2987:Map4k4 UTSW 1 39986765 missense probably damaging 1.00
R3087:Map4k4 UTSW 1 40021082 critical splice acceptor site probably null
R3688:Map4k4 UTSW 1 39985171 splice site probably null
R4075:Map4k4 UTSW 1 40023462 missense probably damaging 0.96
R4304:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R4564:Map4k4 UTSW 1 39988975 missense probably damaging 1.00
R4569:Map4k4 UTSW 1 40000538 missense probably damaging 1.00
R4613:Map4k4 UTSW 1 40017191 missense probably benign 0.05
R4715:Map4k4 UTSW 1 40019564 missense probably damaging 1.00
R4788:Map4k4 UTSW 1 40003916 missense probably benign 0.01
R4926:Map4k4 UTSW 1 40017225 missense probably damaging 1.00
R4943:Map4k4 UTSW 1 40019594 missense probably damaging 0.99
R5033:Map4k4 UTSW 1 40007502 missense probably damaging 0.99
R5177:Map4k4 UTSW 1 39986762 missense probably damaging 1.00
R5297:Map4k4 UTSW 1 39962217 missense probably damaging 1.00
R5844:Map4k4 UTSW 1 39999876 splice site probably benign
R5952:Map4k4 UTSW 1 39999922 unclassified probably benign
R6111:Map4k4 UTSW 1 40011662 missense probably benign 0.00
R6125:Map4k4 UTSW 1 40003965 missense possibly damaging 0.77
R6838:Map4k4 UTSW 1 39976722 missense probably damaging 1.00
R6927:Map4k4 UTSW 1 40011682 missense probably benign 0.00
R7008:Map4k4 UTSW 1 39988971 missense probably benign 0.44
R7164:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R7352:Map4k4 UTSW 1 39962227 missense unknown
R7589:Map4k4 UTSW 1 40021091 nonsense probably null
R7816:Map4k4 UTSW 1 40014208 missense possibly damaging 0.53
R7869:Map4k4 UTSW 1 39974044 missense unknown
R8013:Map4k4 UTSW 1 39962212 missense unknown
R8145:Map4k4 UTSW 1 40000534 missense
R8154:Map4k4 UTSW 1 40021142 nonsense probably null
R8254:Map4k4 UTSW 1 40006675 missense probably damaging 0.99
R8266:Map4k4 UTSW 1 40011653 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TCTCTCAGAGGAAATGTGTCTAC -3'
(R):5'- TGAAGGACCTCCCAGCATAC -3'

Sequencing Primer
(F):5'- CAGAGGAAATGTGTCTACTGTTTTTG -3'
(R):5'- TACAATATCTACAAGCTGGAAAGGTG -3'
Posted On2019-06-26