Incidental Mutation 'R7195:Zfp933'
ID 559845
Institutional Source Beutler Lab
Gene Symbol Zfp933
Ensembl Gene ENSMUSG00000059423
Gene Name zinc finger protein 933
Synonyms 2810408P10Rik
MMRRC Submission 045336-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7195 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 147907443-147932823 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 147910636 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 320 (T320I)
Ref Sequence ENSEMBL: ENSMUSP00000101343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105718] [ENSMUST00000135798]
AlphaFold Q6PEE4
Predicted Effect probably benign
Transcript: ENSMUST00000105718
AA Change: T320I

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101343
Gene: ENSMUSG00000059423
AA Change: T320I

DomainStartEndE-ValueType
KRAB 4 66 9.49e-16 SMART
ZnF_C2H2 131 153 3.21e-4 SMART
ZnF_C2H2 159 181 5.21e-4 SMART
ZnF_C2H2 187 209 2.12e-4 SMART
ZnF_C2H2 215 237 7.26e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 1.13e-4 SMART
ZnF_C2H2 299 321 3.95e-4 SMART
ZnF_C2H2 327 349 1.56e-2 SMART
ZnF_C2H2 355 377 1.79e-2 SMART
ZnF_C2H2 383 405 4.24e-4 SMART
ZnF_C2H2 411 433 1.22e-4 SMART
ZnF_C2H2 439 461 4.79e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135798
SMART Domains Protein: ENSMUSP00000118300
Gene: ENSMUSG00000059423

DomainStartEndE-ValueType
Blast:KRAB 1 34 8e-18 BLAST
PDB:2I13|B 32 98 1e-12 PDB
SCOP:d1fgja_ 33 98 5e-13 SMART
Blast:PHD 44 98 6e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,179,242 (GRCm39) probably null Het
Abca2 A G 2: 25,332,088 (GRCm39) D1400G probably benign Het
Actl11 A T 9: 107,806,069 (GRCm39) K131* probably null Het
Adam39 A T 8: 41,277,812 (GRCm39) R68* probably null Het
Akap7 A T 10: 25,147,405 (GRCm39) N108K probably damaging Het
Arhgef10l C A 4: 140,338,721 (GRCm39) A14S probably benign Het
Ccdc141 T G 2: 76,879,927 (GRCm39) N632T probably benign Het
Ccm2 T C 11: 6,546,302 (GRCm39) S435P probably damaging Het
Cd36 A G 5: 18,019,187 (GRCm39) L178P probably damaging Het
Cd7 T C 11: 120,929,075 (GRCm39) I59V probably benign Het
Cds2 T A 2: 132,135,204 (GRCm39) S32T probably benign Het
Cep19 A G 16: 31,925,904 (GRCm39) D104G probably damaging Het
Col1a2 C T 6: 4,510,753 (GRCm39) P68S unknown Het
Col20a1 A G 2: 180,649,024 (GRCm39) H1011R probably damaging Het
Cspg4b A T 13: 113,504,463 (GRCm39) D1864V Het
D7Ertd443e A G 7: 133,896,851 (GRCm39) V513A probably damaging Het
Egfr C T 11: 16,818,162 (GRCm39) P228L probably damaging Het
Fam243 C T 16: 92,118,037 (GRCm39) V84M probably damaging Het
Fam78b A G 1: 166,906,131 (GRCm39) R97G probably damaging Het
Flt1 C T 5: 147,540,386 (GRCm39) V768M probably damaging Het
Gdap1l1 A T 2: 163,288,050 (GRCm39) N96Y probably damaging Het
Gm7168 T A 17: 14,169,622 (GRCm39) Y330N probably benign Het
Hnrnpul1 T C 7: 25,424,203 (GRCm39) N683S unknown Het
Ice2 C T 9: 69,335,782 (GRCm39) P922S possibly damaging Het
Iglv2 A G 16: 19,079,260 (GRCm39) V81A not run Het
Irs1 A G 1: 82,265,177 (GRCm39) I1013T probably benign Het
Itih4 T C 14: 30,621,432 (GRCm39) S832P probably damaging Het
Klhl1 A T 14: 96,517,513 (GRCm39) Y388N probably benign Het
Lrrc37a G A 11: 103,348,601 (GRCm39) S2698L unknown Het
Map4k4 T C 1: 40,058,829 (GRCm39) Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 (GRCm39) G1519W probably damaging Het
Mga T A 2: 119,747,809 (GRCm39) D653E probably damaging Het
Npas1 T C 7: 16,208,733 (GRCm39) E48G probably damaging Het
Nup188 G A 2: 30,231,842 (GRCm39) probably null Het
Or1p1b G T 11: 74,130,394 (GRCm39) M1I probably null Het
Or3a4 T A 11: 73,945,223 (GRCm39) M121L probably damaging Het
Or4c110 G A 2: 88,832,075 (GRCm39) L186F Het
Or51a39 A G 7: 102,362,873 (GRCm39) V249A possibly damaging Het
Or55b4 A T 7: 102,133,574 (GRCm39) V251D probably damaging Het
Or7h8 A G 9: 20,123,840 (GRCm39) N65S probably damaging Het
Oxct1 T C 15: 4,158,383 (GRCm39) V439A probably damaging Het
Pcdhb22 G T 18: 37,652,341 (GRCm39) G13W probably damaging Het
Pex11g A G 8: 3,509,237 (GRCm39) V230A probably benign Het
Pop1 C T 15: 34,510,525 (GRCm39) S439L probably damaging Het
Ptpn9 T A 9: 56,929,533 (GRCm39) H83Q probably benign Het
Qrfp C T 2: 31,698,704 (GRCm39) R76H probably benign Het
Slc30a3 A G 5: 31,246,139 (GRCm39) V197A probably benign Het
Slc8a3 T C 12: 81,361,047 (GRCm39) N591D possibly damaging Het
Sp4 G T 12: 118,263,807 (GRCm39) Q80K possibly damaging Het
Spock1 C T 13: 58,055,316 (GRCm39) G29D possibly damaging Het
Sprr1a G T 3: 92,391,674 (GRCm39) P109Q probably damaging Het
Suz12 T A 11: 79,904,309 (GRCm39) F239L probably damaging Het
Tbx3 A G 5: 119,813,648 (GRCm39) Y248C probably damaging Het
Trabd2b T C 4: 114,266,637 (GRCm39) L217P probably damaging Het
Ubxn11 A C 4: 133,853,726 (GRCm39) I398L possibly damaging Het
Vmn1r173 T A 7: 23,401,884 (GRCm39) S40T probably damaging Het
Vmn2r2 T C 3: 64,023,900 (GRCm39) S894G probably benign Het
Vmn2r65 A G 7: 84,592,347 (GRCm39) probably null Het
Vps13c G A 9: 67,853,107 (GRCm39) G2400D possibly damaging Het
Vps8 T C 16: 21,275,032 (GRCm39) Y197H probably damaging Het
Wdr91 T C 6: 34,866,209 (GRCm39) N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 (GRCm39) I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,547 (GRCm39) D133G probably benign Het
Zcchc14 T C 8: 122,335,200 (GRCm39) I307V unknown Het
Other mutations in Zfp933
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp933 APN 4 147,910,778 (GRCm39) missense probably damaging 1.00
IGL03377:Zfp933 APN 4 147,913,168 (GRCm39) missense possibly damaging 0.65
F5770:Zfp933 UTSW 4 147,910,927 (GRCm39) missense probably damaging 0.98
FR4340:Zfp933 UTSW 4 147,910,186 (GRCm39) frame shift probably null
FR4548:Zfp933 UTSW 4 147,910,188 (GRCm39) frame shift probably null
R0388:Zfp933 UTSW 4 147,910,899 (GRCm39) missense probably benign 0.35
R0523:Zfp933 UTSW 4 147,910,919 (GRCm39) nonsense probably null
R0539:Zfp933 UTSW 4 147,911,005 (GRCm39) missense probably benign 0.08
R1672:Zfp933 UTSW 4 147,910,476 (GRCm39) missense probably damaging 1.00
R4049:Zfp933 UTSW 4 147,910,969 (GRCm39) missense probably damaging 1.00
R4895:Zfp933 UTSW 4 147,910,892 (GRCm39) nonsense probably null
R5133:Zfp933 UTSW 4 147,911,321 (GRCm39) missense probably benign
R5786:Zfp933 UTSW 4 147,912,864 (GRCm39) splice site probably null
R5891:Zfp933 UTSW 4 147,911,231 (GRCm39) missense probably benign 0.03
R6111:Zfp933 UTSW 4 147,913,217 (GRCm39) missense probably damaging 1.00
R6382:Zfp933 UTSW 4 147,910,325 (GRCm39) missense probably benign 0.07
R6968:Zfp933 UTSW 4 147,910,654 (GRCm39) missense probably damaging 1.00
R7555:Zfp933 UTSW 4 147,910,589 (GRCm39) missense probably damaging 1.00
R7902:Zfp933 UTSW 4 147,911,058 (GRCm39) missense probably damaging 0.96
R8319:Zfp933 UTSW 4 147,912,910 (GRCm39) missense possibly damaging 0.87
R8688:Zfp933 UTSW 4 147,911,249 (GRCm39) missense probably benign 0.14
R9019:Zfp933 UTSW 4 147,911,021 (GRCm39) missense probably damaging 1.00
RF024:Zfp933 UTSW 4 147,910,898 (GRCm39) missense probably damaging 1.00
RF028:Zfp933 UTSW 4 147,910,188 (GRCm39) frame shift probably null
RF035:Zfp933 UTSW 4 147,910,188 (GRCm39) makesense probably null
RF043:Zfp933 UTSW 4 147,910,188 (GRCm39) frame shift probably null
V7581:Zfp933 UTSW 4 147,910,927 (GRCm39) missense probably damaging 0.98
V7582:Zfp933 UTSW 4 147,910,927 (GRCm39) missense probably damaging 0.98
V7583:Zfp933 UTSW 4 147,910,927 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTTTGTGAAAAGGCTGAACCA -3'
(R):5'- TTGCGCAAAATGGTCATCTCATAATA -3'

Sequencing Primer
(F):5'- CTGCAAAGGCTTTACCACATTG -3'
(R):5'- TACACAAAAGAACACATACCGGAGAG -3'
Posted On 2019-06-26