Incidental Mutation 'R7195:Zfp933'
ID 559845
Institutional Source Beutler Lab
Gene Symbol Zfp933
Ensembl Gene ENSMUSG00000059423
Gene Name zinc finger protein 933
Synonyms 2810408P10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7195 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 147822986-147848366 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 147826179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 320 (T320I)
Ref Sequence ENSEMBL: ENSMUSP00000101343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105718] [ENSMUST00000135798]
AlphaFold Q6PEE4
Predicted Effect probably benign
Transcript: ENSMUST00000105718
AA Change: T320I

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101343
Gene: ENSMUSG00000059423
AA Change: T320I

DomainStartEndE-ValueType
KRAB 4 66 9.49e-16 SMART
ZnF_C2H2 131 153 3.21e-4 SMART
ZnF_C2H2 159 181 5.21e-4 SMART
ZnF_C2H2 187 209 2.12e-4 SMART
ZnF_C2H2 215 237 7.26e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 1.13e-4 SMART
ZnF_C2H2 299 321 3.95e-4 SMART
ZnF_C2H2 327 349 1.56e-2 SMART
ZnF_C2H2 355 377 1.79e-2 SMART
ZnF_C2H2 383 405 4.24e-4 SMART
ZnF_C2H2 411 433 1.22e-4 SMART
ZnF_C2H2 439 461 4.79e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135798
SMART Domains Protein: ENSMUSP00000118300
Gene: ENSMUSG00000059423

DomainStartEndE-ValueType
Blast:KRAB 1 34 8e-18 BLAST
PDB:2I13|B 32 98 1e-12 PDB
SCOP:d1fgja_ 33 98 5e-13 SMART
Blast:PHD 44 98 6e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Other mutations in Zfp933
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp933 APN 4 147826321 missense probably damaging 1.00
IGL03377:Zfp933 APN 4 147828711 missense possibly damaging 0.65
F5770:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
FR4340:Zfp933 UTSW 4 147825729 frame shift probably null
FR4548:Zfp933 UTSW 4 147825731 frame shift probably null
R0388:Zfp933 UTSW 4 147826442 missense probably benign 0.35
R0523:Zfp933 UTSW 4 147826462 nonsense probably null
R0539:Zfp933 UTSW 4 147826548 missense probably benign 0.08
R1672:Zfp933 UTSW 4 147826019 missense probably damaging 1.00
R4049:Zfp933 UTSW 4 147826512 missense probably damaging 1.00
R4895:Zfp933 UTSW 4 147826435 nonsense probably null
R5133:Zfp933 UTSW 4 147826864 missense probably benign
R5786:Zfp933 UTSW 4 147828407 splice site probably null
R5891:Zfp933 UTSW 4 147826774 missense probably benign 0.03
R6111:Zfp933 UTSW 4 147828760 missense probably damaging 1.00
R6382:Zfp933 UTSW 4 147825868 missense probably benign 0.07
R6968:Zfp933 UTSW 4 147826197 missense probably damaging 1.00
R7555:Zfp933 UTSW 4 147826132 missense probably damaging 1.00
R7902:Zfp933 UTSW 4 147826601 missense probably damaging 0.96
R8319:Zfp933 UTSW 4 147828453 missense possibly damaging 0.87
R8688:Zfp933 UTSW 4 147826792 missense probably benign 0.14
R9019:Zfp933 UTSW 4 147826564 missense probably damaging 1.00
RF024:Zfp933 UTSW 4 147826441 missense probably damaging 1.00
RF028:Zfp933 UTSW 4 147825731 frame shift probably null
RF035:Zfp933 UTSW 4 147825731 makesense probably null
RF043:Zfp933 UTSW 4 147825731 frame shift probably null
V7581:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
V7582:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
V7583:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTTTGTGAAAAGGCTGAACCA -3'
(R):5'- TTGCGCAAAATGGTCATCTCATAATA -3'

Sequencing Primer
(F):5'- CTGCAAAGGCTTTACCACATTG -3'
(R):5'- TACACAAAAGAACACATACCGGAGAG -3'
Posted On 2019-06-26