Incidental Mutation 'R7195:Zfp933'
ID559845
Institutional Source Beutler Lab
Gene Symbol Zfp933
Ensembl Gene ENSMUSG00000059423
Gene Namezinc finger protein 933
Synonyms2810408P10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location147822986-147848366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147826179 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 320 (T320I)
Ref Sequence ENSEMBL: ENSMUSP00000101343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105718] [ENSMUST00000135798]
Predicted Effect probably benign
Transcript: ENSMUST00000105718
AA Change: T320I

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101343
Gene: ENSMUSG00000059423
AA Change: T320I

DomainStartEndE-ValueType
KRAB 4 66 9.49e-16 SMART
ZnF_C2H2 131 153 3.21e-4 SMART
ZnF_C2H2 159 181 5.21e-4 SMART
ZnF_C2H2 187 209 2.12e-4 SMART
ZnF_C2H2 215 237 7.26e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 1.13e-4 SMART
ZnF_C2H2 299 321 3.95e-4 SMART
ZnF_C2H2 327 349 1.56e-2 SMART
ZnF_C2H2 355 377 1.79e-2 SMART
ZnF_C2H2 383 405 4.24e-4 SMART
ZnF_C2H2 411 433 1.22e-4 SMART
ZnF_C2H2 439 461 4.79e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135798
SMART Domains Protein: ENSMUSP00000118300
Gene: ENSMUSG00000059423

DomainStartEndE-ValueType
Blast:KRAB 1 34 8e-18 BLAST
PDB:2I13|B 32 98 1e-12 PDB
SCOP:d1fgja_ 33 98 5e-13 SMART
Blast:PHD 44 98 6e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Other mutations in Zfp933
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp933 APN 4 147826321 missense probably damaging 1.00
IGL03377:Zfp933 APN 4 147828711 missense possibly damaging 0.65
F5770:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
FR4340:Zfp933 UTSW 4 147825729 frame shift probably null
FR4548:Zfp933 UTSW 4 147825731 frame shift probably null
R0388:Zfp933 UTSW 4 147826442 missense probably benign 0.35
R0523:Zfp933 UTSW 4 147826462 nonsense probably null
R0539:Zfp933 UTSW 4 147826548 missense probably benign 0.08
R1672:Zfp933 UTSW 4 147826019 missense probably damaging 1.00
R4049:Zfp933 UTSW 4 147826512 missense probably damaging 1.00
R4895:Zfp933 UTSW 4 147826435 nonsense probably null
R5133:Zfp933 UTSW 4 147826864 missense probably benign
R5786:Zfp933 UTSW 4 147828407 splice site probably null
R5891:Zfp933 UTSW 4 147826774 missense probably benign 0.03
R6111:Zfp933 UTSW 4 147828760 missense probably damaging 1.00
R6382:Zfp933 UTSW 4 147825868 missense probably benign 0.07
R6968:Zfp933 UTSW 4 147826197 missense probably damaging 1.00
R7555:Zfp933 UTSW 4 147826132 missense probably damaging 1.00
R7902:Zfp933 UTSW 4 147826601 missense probably damaging 0.96
R8319:Zfp933 UTSW 4 147828453 missense possibly damaging 0.87
R8688:Zfp933 UTSW 4 147826792 missense probably benign 0.14
RF024:Zfp933 UTSW 4 147826441 missense probably damaging 1.00
RF028:Zfp933 UTSW 4 147825731 frame shift probably null
RF035:Zfp933 UTSW 4 147825731 makesense probably null
RF043:Zfp933 UTSW 4 147825731 frame shift probably null
V7581:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
V7582:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
V7583:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTTTGTGAAAAGGCTGAACCA -3'
(R):5'- TTGCGCAAAATGGTCATCTCATAATA -3'

Sequencing Primer
(F):5'- CTGCAAAGGCTTTACCACATTG -3'
(R):5'- TACACAAAAGAACACATACCGGAGAG -3'
Posted On2019-06-26