Incidental Mutation 'R7195:Tbx3'
ID559848
Institutional Source Beutler Lab
Gene Symbol Tbx3
Ensembl Gene ENSMUSG00000018604
Gene NameT-box 3
SynonymsD5Ertd189e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location119670669-119684724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119675583 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 248 (Y248C)
Ref Sequence ENSEMBL: ENSMUSP00000018748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018748] [ENSMUST00000079719] [ENSMUST00000121021]
Predicted Effect probably damaging
Transcript: ENSMUST00000018748
AA Change: Y248C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018748
Gene: ENSMUSG00000018604
AA Change: Y248C

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 310 6.4e-125 SMART
Pfam:TBX 323 411 8.8e-29 PFAM
low complexity region 492 510 N/A INTRINSIC
low complexity region 524 538 N/A INTRINSIC
low complexity region 556 576 N/A INTRINSIC
low complexity region 607 620 N/A INTRINSIC
low complexity region 662 710 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079719
AA Change: Y228C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078657
Gene: ENSMUSG00000018604
AA Change: Y228C

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121021
AA Change: Y228C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112519
Gene: ENSMUSG00000018604
AA Change: Y228C

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die are embryonic lethal exhibiting defects in the yolk sac and limb defects. Female embryos show impaired mammary bud induction. Mice homozygous for hypomorphic alleles exhibit varying degrees of prenatal lethality and premature death, heart defects and limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Tbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Tbx3 APN 5 119682643 missense probably benign 0.45
IGL02174:Tbx3 APN 5 119675584 nonsense probably null
IGL02508:Tbx3 APN 5 119678812 missense possibly damaging 0.48
IGL03035:Tbx3 APN 5 119683096 utr 3 prime probably benign
R0047:Tbx3 UTSW 5 119680446 missense probably damaging 0.99
R0184:Tbx3 UTSW 5 119675562 missense probably damaging 1.00
R0365:Tbx3 UTSW 5 119675250 missense possibly damaging 0.81
R1209:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R1956:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R2231:Tbx3 UTSW 5 119677524 missense probably damaging 1.00
R4093:Tbx3 UTSW 5 119680748 missense probably benign
R4400:Tbx3 UTSW 5 119680571 missense probably damaging 0.99
R4578:Tbx3 UTSW 5 119682776 missense probably damaging 0.99
R4693:Tbx3 UTSW 5 119677570 missense possibly damaging 0.72
R4716:Tbx3 UTSW 5 119675670 missense possibly damaging 0.94
R4804:Tbx3 UTSW 5 119680512 missense possibly damaging 0.63
R5664:Tbx3 UTSW 5 119678731 missense possibly damaging 0.48
R5724:Tbx3 UTSW 5 119675603 missense possibly damaging 0.75
R5990:Tbx3 UTSW 5 119680529 missense probably benign 0.02
R6133:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R6180:Tbx3 UTSW 5 119674067 missense probably damaging 1.00
R6429:Tbx3 UTSW 5 119674191 nonsense probably null
R7154:Tbx3 UTSW 5 119672028 missense possibly damaging 0.89
R7352:Tbx3 UTSW 5 119677560 missense probably benign 0.00
R8050:Tbx3 UTSW 5 119683067 missense probably benign 0.38
R8089:Tbx3 UTSW 5 119680569 missense probably damaging 0.98
X0063:Tbx3 UTSW 5 119680881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCCAGAAGATAACATCTGTGG -3'
(R):5'- ATTCCAGACTCTCTGCCCAAG -3'

Sequencing Primer
(F):5'- TCTGTGGAGTGAAACATACCC -3'
(R):5'- GCCCAAGGCCCTGTTTAAC -3'
Posted On2019-06-26