Mutagenetix > Incidental Mutations

Incidental Mutation 'R7195:Col1a2'

559850

Institutional Source

Beutler Lab

Gene Symbol

Col1a2

Ensembl Gene

ENSMUSG00000029661

Gene Name

collagen, type I, alpha 2

Synonyms

Cola2, Cola-2, Col1a-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7195 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4504814-4541544 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4510753 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 68 (P68S)

Ref Sequence

ENSEMBL: ENSMUSP00000031668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031668] [ENSMUST00000141483]

Predicted Effect

unknown
Transcript: ENSMUST00000031668
AA Change: P68S

SMART Domains

Protein: ENSMUSP00000031668
Gene: ENSMUSG00000029661
AA Change: P68S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Collagen	30	91	1e-8	PFAM
Pfam:Collagen	88	155	8.2e-10	PFAM
internal_repeat_3	172	223	7.52e-12	PROSPERO
low complexity region	225	271	N/A	INTRINSIC
low complexity region	274	313	N/A	INTRINSIC
low complexity region	316	352	N/A	INTRINSIC
internal_repeat_2	354	386	2.06e-15	PROSPERO
internal_repeat_1	355	469	5.71e-17	PROSPERO
internal_repeat_4	361	472	2.1e-11	PROSPERO
Pfam:Collagen	475	535	7.7e-11	PFAM
Pfam:Collagen	521	588	8.2e-10	PFAM
low complexity region	598	625	N/A	INTRINSIC
low complexity region	628	655	N/A	INTRINSIC
low complexity region	679	722	N/A	INTRINSIC
low complexity region	724	757	N/A	INTRINSIC
low complexity region	759	784	N/A	INTRINSIC
low complexity region	792	820	N/A	INTRINSIC
internal_repeat_5	823	850	5.93e-7	PROSPERO
low complexity region	853	883	N/A	INTRINSIC
Pfam:Collagen	895	969	1e-8	PFAM
low complexity region	987	1007	N/A	INTRINSIC
internal_repeat_5	1009	1042	5.93e-7	PROSPERO
Pfam:Collagen	1051	1120	5.8e-9	PFAM
COLFI	1138	1372	2.1e-150	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000141483
AA Change: P68S

SMART Domains

Protein: ENSMUSP00000125275
Gene: ENSMUSG00000029661
AA Change: P68S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Collagen	30	89	3.2e-10	PFAM
Pfam:Collagen	87	145	8.5e-10	PFAM
Pfam:Collagen	121	177	3.3e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-1 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice harboring certain mutations in the encoded gene exhibit symptoms of moderate to severe forms of osteogenesis imperfecta. [provided by RefSeq, Dec 2015]
PHENOTYPE: The tails of mice heterozygous for an ENU-induced mutation at this locus are flexible or rubbery. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	T	C	11: 58,288,416		probably null	Het
4930563D23Rik	C	T	16: 92,321,149	V84M	probably damaging	Het
Abca2	A	G	2: 25,442,076	D1400G	probably benign	Het
Actl11	A	T	9: 107,928,870	K131*	probably null	Het
Adam39	A	T	8: 40,824,775	R68*	probably null	Het
Akap7	A	T	10: 25,271,507	N108K	probably damaging	Het
Arhgef10l	C	A	4: 140,611,410	A14S	probably benign	Het
BC067074	A	T	13: 113,367,929	D1864V		Het
Ccdc141	T	G	2: 77,049,583	N632T	probably benign	Het
Ccm2	T	C	11: 6,596,302	S435P	probably damaging	Het
Cd36	A	G	5: 17,814,189	L178P	probably damaging	Het
Cd7	T	C	11: 121,038,249	I59V	probably benign	Het
Cds2	T	A	2: 132,293,284	S32T	probably benign	Het
Cep19	A	G	16: 32,107,086	D104G	probably damaging	Het
Col20a1	A	G	2: 181,007,231	H1011R	probably damaging	Het
D7Ertd443e	A	G	7: 134,295,122	V513A	probably damaging	Het
Egfr	C	T	11: 16,868,162	P228L	probably damaging	Het
Fam78b	A	G	1: 167,078,562	R97G	probably damaging	Het
Flt1	C	T	5: 147,603,576	V768M	probably damaging	Het
Gdap1l1	A	T	2: 163,446,130	N96Y	probably damaging	Het
Gm7168	T	A	17: 13,949,360	Y330N	probably benign	Het
Hnrnpul1	T	C	7: 25,724,778	N683S	unknown	Het
Ice2	C	T	9: 69,428,500	P922S	possibly damaging	Het
Iglv2	A	G	16: 19,260,510	V81A	not run	Het
Irs1	A	G	1: 82,287,456	I1013T	probably benign	Het
Itih4	T	C	14: 30,899,475	S832P	probably damaging	Het
Klhl1	A	T	14: 96,280,077	Y388N	probably benign	Het
Lrrc37a	G	A	11: 103,457,775	S2698L	unknown	Het
Map4k4	T	C	1: 40,019,669	Y1008H	possibly damaging	Het
Mdn1	G	T	4: 32,701,823	G1519W	probably damaging	Het
Mga	T	A	2: 119,917,328	D653E	probably damaging	Het
Npas1	T	C	7: 16,474,808	E48G	probably damaging	Het
Nup188	G	A	2: 30,341,830		probably null	Het
Olfr1215	G	A	2: 89,001,731	L186F		Het
Olfr33	A	G	7: 102,713,666	V249A	possibly damaging	Het
Olfr399	T	A	11: 74,054,397	M121L	probably damaging	Het
Olfr404-ps1	G	T	11: 74,239,568	M1I	probably null	Het
Olfr544	A	T	7: 102,484,367	V251D	probably damaging	Het
Olfr871	A	G	9: 20,212,544	N65S	probably damaging	Het
Oxct1	T	C	15: 4,128,901	V439A	probably damaging	Het
Pcdhb22	G	T	18: 37,519,288	G13W	probably damaging	Het
Pex11g	A	G	8: 3,459,237	V230A	probably benign	Het
Pop1	C	T	15: 34,510,379	S439L	probably damaging	Het
Ptpn9	T	A	9: 57,022,249	H83Q	probably benign	Het
Qrfp	C	T	2: 31,808,692	R76H	probably benign	Het
Slc30a3	A	G	5: 31,088,795	V197A	probably benign	Het
Slc8a3	T	C	12: 81,314,273	N591D	possibly damaging	Het
Sp4	G	T	12: 118,300,072	Q80K	possibly damaging	Het
Spock1	C	T	13: 57,907,502	G29D	possibly damaging	Het
Sprr1a	G	T	3: 92,484,367	P109Q	probably damaging	Het
Suz12	T	A	11: 80,013,483	F239L	probably damaging	Het
Tbx3	A	G	5: 119,675,583	Y248C	probably damaging	Het
Trabd2b	T	C	4: 114,409,440	L217P	probably damaging	Het
Ubxn11	A	C	4: 134,126,415	I398L	possibly damaging	Het
Vmn1r173	T	A	7: 23,702,459	S40T	probably damaging	Het
Vmn2r2	T	C	3: 64,116,479	S894G	probably benign	Het
Vmn2r65	A	G	7: 84,943,139		probably null	Het
Vps13c	G	A	9: 67,945,825	G2400D	possibly damaging	Het
Vps8	T	C	16: 21,456,282	Y197H	probably damaging	Het
Wdr91	T	C	6: 34,889,274	N486D	possibly damaging	Het
Wwp1	A	G	4: 19,627,908	I695T	possibly damaging	Het
Zc3hc1	T	C	6: 30,382,548	D133G	probably benign	Het
Zcchc14	T	C	8: 121,608,461	I307V	unknown	Het
Zfp933	G	A	4: 147,826,179	T320I	probably benign	Het

Other mutations in Col1a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Col1a2	APN	6	4531095	splice site	probably benign
IGL01126:Col1a2	APN	6	4535846	missense	unknown
IGL01129:Col1a2	APN	6	4535846	missense	unknown
IGL01286:Col1a2	APN	6	4533891	missense	unknown
IGL01687:Col1a2	APN	6	4520258	nonsense	probably null
IGL01866:Col1a2	APN	6	4524132	missense	probably damaging	1.00
IGL02010:Col1a2	APN	6	4512416	critical splice donor site	probably null
IGL02100:Col1a2	APN	6	4524177	splice site	probably benign
IGL02140:Col1a2	APN	6	4515639	missense	unknown
IGL02474:Col1a2	APN	6	4516398	missense	unknown
IGL02510:Col1a2	APN	6	4516398	missense	unknown
IGL02525:Col1a2	APN	6	4531355	splice site	probably benign
IGL02839:Col1a2	APN	6	4538748	missense	unknown
IGL03134:Col1a2	APN	6	4521387	unclassified	probably benign
IGL03385:Col1a2	APN	6	4539612	missense	unknown
P4717OSA:Col1a2	UTSW	6	4518822	unclassified	probably benign
PIT4453001:Col1a2	UTSW	6	4527079	missense	possibly damaging	0.94
R0021:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0022:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0025:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0027:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0028:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0031:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0038:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0064:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0102:Col1a2	UTSW	6	4520775	missense	possibly damaging	0.92
R0147:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0323:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0326:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0326:Col1a2	UTSW	6	4537838	missense	unknown
R0335:Col1a2	UTSW	6	4531956	splice site	probably benign
R0359:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0363:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0612:Col1a2	UTSW	6	4516003	missense	unknown
R0729:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0746:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0760:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0761:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0801:Col1a2	UTSW	6	4531316	missense	unknown
R0845:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0846:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0969:Col1a2	UTSW	6	4518822	unclassified	probably benign
R0970:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1105:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1106:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1107:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1134:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1135:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1152:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1333:Col1a2	UTSW	6	4515684	critical splice donor site	probably null
R1341:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1470:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1470:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1477:Col1a2	UTSW	6	4539673	missense	unknown
R1566:Col1a2	UTSW	6	4523613	missense	probably damaging	1.00
R1691:Col1a2	UTSW	6	4536038	missense	unknown
R1713:Col1a2	UTSW	6	4538691	missense	unknown
R1754:Col1a2	UTSW	6	4518822	unclassified	probably benign
R1755:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2050:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2178:Col1a2	UTSW	6	4531143	missense	unknown
R2194:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2195:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2235:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2261:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2262:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2263:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2289:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2310:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2312:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2330:Col1a2	UTSW	6	4528300	splice site	probably benign
R2333:Col1a2	UTSW	6	4532747	missense	unknown
R2401:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2403:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2448:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2513:Col1a2	UTSW	6	4531223	splice site	probably null
R2862:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2884:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2885:Col1a2	UTSW	6	4518822	unclassified	probably benign
R2913:Col1a2	UTSW	6	4519923	unclassified	probably benign
R2937:Col1a2	UTSW	6	4519882	unclassified	probably benign
R2937:Col1a2	UTSW	6	4520788	missense	possibly damaging	0.92
R2938:Col1a2	UTSW	6	4520788	missense	possibly damaging	0.92
R3608:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3692:Col1a2	UTSW	6	4510710	missense	possibly damaging	0.84
R3805:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3806:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3826:Col1a2	UTSW	6	4516960	unclassified	probably benign
R3903:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3904:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3922:Col1a2	UTSW	6	4518822	unclassified	probably benign
R3926:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4106:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4107:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4108:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4109:Col1a2	UTSW	6	4510705	nonsense	probably null
R4509:Col1a2	UTSW	6	4518822	unclassified	probably benign
R4667:Col1a2	UTSW	6	4512412	missense	unknown
R4909:Col1a2	UTSW	6	4529058	splice site	probably benign
R5418:Col1a2	UTSW	6	4516931	unclassified	probably benign
R5587:Col1a2	UTSW	6	4540531	missense	unknown
R5598:Col1a2	UTSW	6	4516916	unclassified	probably benign
R5673:Col1a2	UTSW	6	4539622	missense	unknown
R5678:Col1a2	UTSW	6	4536239	missense	unknown
R5763:Col1a2	UTSW	6	4515682	missense	unknown
R5786:Col1a2	UTSW	6	4530223	missense	unknown
R5872:Col1a2	UTSW	6	4531926	missense	unknown
R6084:Col1a2	UTSW	6	4505840	start codon destroyed	probably benign	0.01
R6134:Col1a2	UTSW	6	4538035	missense	unknown
R6221:Col1a2	UTSW	6	4539490	missense	unknown
R6481:Col1a2	UTSW	6	4538680	missense	unknown
R6500:Col1a2	UTSW	6	4515517	missense	unknown
R6890:Col1a2	UTSW	6	4539587	missense	unknown
R7022:Col1a2	UTSW	6	4534639	missense	unknown
R7033:Col1a2	UTSW	6	4516904	unclassified	probably benign
R7657:Col1a2	UTSW	6	4527152	missense	probably null	0.99
R7686:Col1a2	UTSW	6	4518964	missense	unknown
R7875:Col1a2	UTSW	6	4518500	missense	unknown
R8023:Col1a2	UTSW	6	4533847	missense	unknown
R8208:Col1a2	UTSW	6	4515260	splice site	probably null
R8277:Col1a2	UTSW	6	4516410	missense	probably null
R8438:Col1a2	UTSW	6	4515517	missense	unknown
R8438:Col1a2	UTSW	6	4515518	missense	unknown
V5622:Col1a2	UTSW	6	4518822	unclassified	probably benign
V5622:Col1a2	UTSW	6	4518822	unclassified	probably benign
X0017:Col1a2	UTSW	6	4515675	missense	unknown
Z1176:Col1a2	UTSW	6	4532750	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACTGACCTTAGCATGTGTGTTC -3'
(R):5'- GGACTGTAATTGACAAGACCCTG -3'

Sequencing Primer
(F):5'- ACCTTAGCATGTGTGTTCTTAGGTC -3'
(R):5'- CTGTAATTGACAAGACCCTGAGGAAG -3'

Posted On

2019-06-26