Incidental Mutation 'R7195:Zc3hc1'
ID559851
Institutional Source Beutler Lab
Gene Symbol Zc3hc1
Ensembl Gene ENSMUSG00000039130
Gene Namezinc finger, C3HC type 1
Synonyms1110054L24Rik, Nipa, HSPC216
MMRRC Submission
Accession Numbers

Genbank: NM_172735; MGI: 1916023

Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location30366380-30391028 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30382548 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000079627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080812] [ENSMUST00000102992] [ENSMUST00000115184] [ENSMUST00000136255] [ENSMUST00000152391]
Predicted Effect probably benign
Transcript: ENSMUST00000080812
AA Change: D133G

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079627
Gene: ENSMUSG00000039130
AA Change: D133G

DomainStartEndE-ValueType
Pfam:zf-C3HC 72 201 2e-38 PFAM
low complexity region 216 231 N/A INTRINSIC
Pfam:Rsm1 248 343 6.8e-14 PFAM
low complexity region 406 420 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102992
AA Change: D133G

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100057
Gene: ENSMUSG00000039130
AA Change: D133G

DomainStartEndE-ValueType
Pfam:zf-C3HC 72 201 2.4e-37 PFAM
low complexity region 216 231 N/A INTRINSIC
Pfam:Rsm1 248 343 2.2e-13 PFAM
low complexity region 406 420 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115184
AA Change: D133G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110838
Gene: ENSMUSG00000039130
AA Change: D133G

DomainStartEndE-ValueType
Pfam:zf-C3HC 72 201 5.9e-38 PFAM
low complexity region 216 231 N/A INTRINSIC
Pfam:Rsm1 248 339 8.6e-14 PFAM
Pfam:Rsm1 331 394 4.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136255
Predicted Effect probably benign
Transcript: ENSMUST00000147990
Predicted Effect possibly damaging
Transcript: ENSMUST00000152391
AA Change: D133G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135447
Gene: ENSMUSG00000039130
AA Change: D133G

DomainStartEndE-ValueType
Pfam:zf-C3HC 72 201 9e-38 PFAM
low complexity region 216 231 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an F-box-containing protein that is a component of an SCF-type E3 ubiquitin ligase complex that regulates the onset of cell division. The G2/M transition in the cell cycle requires the interaction of the proteins cyclin B1 and cyclin-dependent kinase 1. The activated ubiquitin ligase complex targets the protein cyclin B1 for degradation, preventing this transition to mitosis. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality with male infertility, reduced female fertility, arrest of meiosis, impaired synaptonemal complex formation and delayed double strand DNA break repair. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Zc3hc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Zc3hc1 APN 6 30390863 missense probably benign 0.43
IGL01843:Zc3hc1 APN 6 30372730 splice site probably benign
IGL02358:Zc3hc1 APN 6 30376058 missense probably benign 0.04
IGL02379:Zc3hc1 APN 6 30390975 missense probably benign 0.38
IGL02567:Zc3hc1 APN 6 30374849 missense probably benign
F6893:Zc3hc1 UTSW 6 30387526 missense probably benign 0.07
R0376:Zc3hc1 UTSW 6 30372790 missense probably damaging 1.00
R0532:Zc3hc1 UTSW 6 30374930 splice site probably benign
R1521:Zc3hc1 UTSW 6 30376025 missense probably benign 0.00
R1690:Zc3hc1 UTSW 6 30390941 missense probably damaging 0.96
R1861:Zc3hc1 UTSW 6 30374838 missense probably benign
R3085:Zc3hc1 UTSW 6 30374764 critical splice donor site probably null
R4619:Zc3hc1 UTSW 6 30387524 missense probably benign 0.27
R4721:Zc3hc1 UTSW 6 30374900 missense probably benign 0.03
R4847:Zc3hc1 UTSW 6 30375982 missense probably benign 0.18
R5000:Zc3hc1 UTSW 6 30375988 missense possibly damaging 0.67
R5870:Zc3hc1 UTSW 6 30382683 nonsense probably null
R8164:Zc3hc1 UTSW 6 30390896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCACCGTGTCACACATC -3'
(R):5'- TCTGCTTTTAATGAGTGCATGC -3'

Sequencing Primer
(F):5'- TGTCACACATCAACAGCACATTATTG -3'
(R):5'- CTGCTTTTAATGAGTGCATGCCTATG -3'
Posted On2019-06-26