Incidental Mutation 'R7195:Npas1'
ID559853
Institutional Source Beutler Lab
Gene Symbol Npas1
Ensembl Gene ENSMUSG00000001988
Gene Nameneuronal PAS domain protein 1
SynonymsbHLHe11, MOP5
MMRRC Submission
Accession Numbers

Genbank: NM_008718; MGI: 109205

Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16455721-16477728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16474808 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 48 (E48G)
Ref Sequence ENSEMBL: ENSMUSP00000147412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002053] [ENSMUST00000210748]
Predicted Effect probably damaging
Transcript: ENSMUST00000002053
AA Change: E48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002053
Gene: ENSMUSG00000001988
AA Change: E48G

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
HLH 51 106 1.44e-6 SMART
low complexity region 109 128 N/A INTRINSIC
PAS 137 203 1.09e-11 SMART
low complexity region 212 223 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
PAS 294 360 5.32e-6 SMART
PAC 366 409 5.64e0 SMART
low complexity region 428 443 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210748
AA Change: E48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. Studies of a related mouse gene suggest that it functions in neurons. The exact function of this gene is unclear, but it may play protective or modulatory roles during late embryogenesis and postnatal development. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Npas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Npas1 APN 7 16463322 missense probably benign 0.05
IGL01627:Npas1 APN 7 16465186 missense probably damaging 1.00
IGL02812:Npas1 APN 7 16456116 missense probably damaging 1.00
IGL03141:Npas1 APN 7 16465138 missense probably damaging 1.00
D4043:Npas1 UTSW 7 16463244 splice site probably null
H8786:Npas1 UTSW 7 16461350 missense possibly damaging 0.51
R0218:Npas1 UTSW 7 16461893 missense probably benign 0.39
R1736:Npas1 UTSW 7 16474616 missense probably benign 0.24
R1795:Npas1 UTSW 7 16474800 missense probably damaging 1.00
R2093:Npas1 UTSW 7 16459277 missense probably benign
R2570:Npas1 UTSW 7 16474703 missense probably damaging 1.00
R4057:Npas1 UTSW 7 16474787 missense probably damaging 1.00
R4385:Npas1 UTSW 7 16459185 critical splice donor site probably null
R5937:Npas1 UTSW 7 16463262 missense probably benign 0.15
R6456:Npas1 UTSW 7 16461926 missense probably benign 0.44
R7544:Npas1 UTSW 7 16460974 intron probably null
R8221:Npas1 UTSW 7 16455965 missense probably damaging 1.00
Z1177:Npas1 UTSW 7 16462253 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCAATCCTGTCCCCAAGG -3'
(R):5'- AGACCTTCAGTTCAAACCCTAGTAC -3'

Sequencing Primer
(F):5'- TGAGCATGCGCACTCAC -3'
(R):5'- GTTCAAACCCTAGTACCCCAAATAC -3'
Posted On2019-06-26