Incidental Mutation 'R7195:D7Ertd443e'
ID559859
Institutional Source Beutler Lab
Gene Symbol D7Ertd443e
Ensembl Gene ENSMUSG00000030994
Gene NameDNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location134265779-134385661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134295122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 513 (V513A)
Ref Sequence ENSEMBL: ENSMUSP00000134479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094002] [ENSMUST00000106129] [ENSMUST00000172947] [ENSMUST00000174700]
Predicted Effect probably damaging
Transcript: ENSMUST00000094002
AA Change: V466A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091539
Gene: ENSMUSG00000030994
AA Change: V466A

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Pfam:ALMS_motif 511 644 3.7e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106129
AA Change: V107A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101735
Gene: ENSMUSG00000030994
AA Change: V107A

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
low complexity region 119 135 N/A INTRINSIC
Pfam:ALMS_motif 152 285 7.4e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172947
AA Change: V513A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134479
Gene: ENSMUSG00000030994
AA Change: V513A

DomainStartEndE-ValueType
low complexity region 226 239 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 525 541 N/A INTRINSIC
Pfam:ALMS_motif 559 689 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174700
SMART Domains Protein: ENSMUSP00000134411
Gene: ENSMUSG00000030994

DomainStartEndE-ValueType
Pfam:ALMS_motif 25 98 2.3e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in D7Ertd443e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:D7Ertd443e APN 7 134349400 missense possibly damaging 0.56
R0369:D7Ertd443e UTSW 7 134298137 missense possibly damaging 0.56
R0501:D7Ertd443e UTSW 7 134294972 missense probably damaging 1.00
R1073:D7Ertd443e UTSW 7 134270218 missense probably damaging 1.00
R1083:D7Ertd443e UTSW 7 134348934 nonsense probably null
R1744:D7Ertd443e UTSW 7 134349413 missense probably benign 0.00
R1801:D7Ertd443e UTSW 7 134270212 missense probably damaging 1.00
R1807:D7Ertd443e UTSW 7 134293305 missense probably null 1.00
R2050:D7Ertd443e UTSW 7 134266798 missense probably damaging 1.00
R2273:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2274:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2504:D7Ertd443e UTSW 7 134349479 unclassified probably null
R3699:D7Ertd443e UTSW 7 134349068 missense probably damaging 1.00
R4348:D7Ertd443e UTSW 7 134348953 frame shift probably null
R4516:D7Ertd443e UTSW 7 134293328 missense probably damaging 1.00
R5123:D7Ertd443e UTSW 7 134349668 unclassified probably null
R5440:D7Ertd443e UTSW 7 134349275 missense probably damaging 0.96
R5555:D7Ertd443e UTSW 7 134349591 missense probably benign 0.00
R5711:D7Ertd443e UTSW 7 134349381 missense probably benign 0.43
R5848:D7Ertd443e UTSW 7 134349722 missense possibly damaging 0.92
R6049:D7Ertd443e UTSW 7 134298232 missense probably benign 0.01
R6266:D7Ertd443e UTSW 7 134349785 missense probably damaging 1.00
R6408:D7Ertd443e UTSW 7 134349711 missense probably benign 0.27
R6939:D7Ertd443e UTSW 7 134364479 intron probably null
R7352:D7Ertd443e UTSW 7 134349394 missense probably benign 0.03
R7737:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R7843:D7Ertd443e UTSW 7 134349095 missense possibly damaging 0.93
R7845:D7Ertd443e UTSW 7 134270248 missense probably damaging 1.00
Z1088:D7Ertd443e UTSW 7 134294982 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACAGAAGCTTTACCTGCAAAGTC -3'
(R):5'- ATGAGGCTGGATCTTGTCAGC -3'

Sequencing Primer
(F):5'- TGCAAAGTCATAGAACTTGCCAG -3'
(R):5'- TTGTCAGCTTAACAAGGCCCG -3'
Posted On2019-06-26