Incidental Mutation 'R7195:Adam39'
ID559861
Institutional Source Beutler Lab
Gene Symbol Adam39
Ensembl Gene ENSMUSG00000054033
Gene Namea disintegrin and metallopeptidase domain 39
Synonyms1700056P18Rik, testase 9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40822990-40827037 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 40824775 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 68 (R68*)
Ref Sequence ENSEMBL: ENSMUSP00000065783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066814]
Predicted Effect probably null
Transcript: ENSMUST00000066814
AA Change: R68*
SMART Domains Protein: ENSMUSP00000065783
Gene: ENSMUSG00000054033
AA Change: R68*

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 53 178 1.3e-19 PFAM
Pfam:Reprolysin_5 219 398 2.2e-18 PFAM
Pfam:Reprolysin_4 219 406 6.8e-16 PFAM
Pfam:Reprolysin 221 410 1.3e-43 PFAM
Pfam:Reprolysin_2 238 399 2.6e-12 PFAM
Pfam:Reprolysin_3 246 366 1.2e-17 PFAM
DISIN 428 503 3.97e-37 SMART
ACR 504 640 8.95e-74 SMART
transmembrane domain 702 724 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Adam39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Adam39 APN 8 40826746 missense possibly damaging 0.53
IGL01350:Adam39 APN 8 40825839 nonsense probably null
IGL02237:Adam39 APN 8 40825445 missense probably benign 0.39
IGL02688:Adam39 APN 8 40826320 missense probably benign 0.00
IGL02890:Adam39 APN 8 40825153 missense probably benign 0.03
IGL03071:Adam39 APN 8 40825067 missense probably benign 0.08
IGL03145:Adam39 APN 8 40824658 missense probably benign 0.00
R0083:Adam39 UTSW 8 40825078 missense probably damaging 0.98
R0086:Adam39 UTSW 8 40826360 missense possibly damaging 0.64
R0546:Adam39 UTSW 8 40826431 missense probably damaging 1.00
R0548:Adam39 UTSW 8 40826467 missense probably damaging 1.00
R1489:Adam39 UTSW 8 40824994 missense possibly damaging 0.49
R1643:Adam39 UTSW 8 40826486 missense possibly damaging 0.83
R1756:Adam39 UTSW 8 40825324 missense probably damaging 0.99
R2081:Adam39 UTSW 8 40826842 makesense probably null
R4510:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4511:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4612:Adam39 UTSW 8 40825921 missense probably damaging 0.96
R4673:Adam39 UTSW 8 40824731 missense probably benign 0.37
R4704:Adam39 UTSW 8 40825796 missense probably benign
R4978:Adam39 UTSW 8 40825337 missense possibly damaging 0.49
R5116:Adam39 UTSW 8 40825001 missense probably damaging 1.00
R5269:Adam39 UTSW 8 40825981 missense probably benign 0.01
R5710:Adam39 UTSW 8 40824647 missense probably benign 0.05
R5971:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6067:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6078:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6180:Adam39 UTSW 8 40826573 missense probably benign 0.03
R6358:Adam39 UTSW 8 40826681 missense probably benign 0.16
R6699:Adam39 UTSW 8 40826657 missense probably benign 0.01
R6896:Adam39 UTSW 8 40824938 missense possibly damaging 0.86
R7117:Adam39 UTSW 8 40826242 missense probably damaging 1.00
R7186:Adam39 UTSW 8 40826312 missense probably damaging 1.00
R7381:Adam39 UTSW 8 40825963 missense probably damaging 1.00
R7405:Adam39 UTSW 8 40824622 missense probably benign 0.01
R8068:Adam39 UTSW 8 40825938 missense not run
R8205:Adam39 UTSW 8 40825043 missense probably benign 0.06
R8239:Adam39 UTSW 8 40825069 missense probably damaging 1.00
U15987:Adam39 UTSW 8 40824593 missense probably benign 0.01
Z1177:Adam39 UTSW 8 40825295 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGGGCATCCTCCTTTGC -3'
(R):5'- AGCAACCATAGACTCTGGGTC -3'

Sequencing Primer
(F):5'- TTTGCTGCCACAGAGGAC -3'
(R):5'- CCATCCATATGGCCATGGTAGTAG -3'
Posted On2019-06-26