Incidental Mutation 'R7195:Zcchc14'
ID559862
Institutional Source Beutler Lab
Gene Symbol Zcchc14
Ensembl Gene ENSMUSG00000061410
Gene Namezinc finger, CCHC domain containing 14
SynonymsBdg29
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location121598703-121652901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121608461 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 307 (I307V)
Ref Sequence ENSEMBL: ENSMUSP00000040360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046386] [ENSMUST00000127664]
Predicted Effect unknown
Transcript: ENSMUST00000046386
AA Change: I307V
SMART Domains Protein: ENSMUSP00000040360
Gene: ENSMUSG00000061410
AA Change: I307V

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
low complexity region 206 225 N/A INTRINSIC
low complexity region 246 265 N/A INTRINSIC
Blast:SAM 299 349 2e-25 BLAST
SCOP:d1kw4a_ 307 358 1e-6 SMART
low complexity region 422 432 N/A INTRINSIC
low complexity region 438 454 N/A INTRINSIC
low complexity region 532 543 N/A INTRINSIC
low complexity region 709 790 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
ZnF_C2HC 914 930 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154725
SMART Domains Protein: ENSMUSP00000120570
Gene: ENSMUSG00000061410

DomainStartEndE-ValueType
low complexity region 7 88 N/A INTRINSIC
low complexity region 89 106 N/A INTRINSIC
ZnF_C2HC 212 228 3.44e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Zcchc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Zcchc14 APN 8 121604615 unclassified probably benign
IGL02060:Zcchc14 APN 8 121603895 missense probably damaging 0.98
IGL02455:Zcchc14 APN 8 121606270 unclassified probably benign
IGL03196:Zcchc14 APN 8 121609138 unclassified probably benign
P0033:Zcchc14 UTSW 8 121610159 intron probably benign
R0483:Zcchc14 UTSW 8 121628649 intron probably benign
R0639:Zcchc14 UTSW 8 121605449 nonsense probably null
R1013:Zcchc14 UTSW 8 121606925 unclassified probably benign
R1129:Zcchc14 UTSW 8 121608415 unclassified probably benign
R1546:Zcchc14 UTSW 8 121604263 intron probably benign
R1563:Zcchc14 UTSW 8 121603979 missense probably benign 0.10
R1861:Zcchc14 UTSW 8 121609251 unclassified probably benign
R2200:Zcchc14 UTSW 8 121605428 unclassified probably benign
R2419:Zcchc14 UTSW 8 121603936 missense probably damaging 0.99
R4246:Zcchc14 UTSW 8 121604292 small deletion probably benign
R4249:Zcchc14 UTSW 8 121604292 small deletion probably benign
R4424:Zcchc14 UTSW 8 121651941 intron probably benign
R4470:Zcchc14 UTSW 8 121651759 intron probably benign
R4520:Zcchc14 UTSW 8 121609095 unclassified probably benign
R4681:Zcchc14 UTSW 8 121608600 unclassified probably benign
R5253:Zcchc14 UTSW 8 121618694 intron probably benign
R5314:Zcchc14 UTSW 8 121608598 unclassified probably benign
R5591:Zcchc14 UTSW 8 121605448 unclassified probably benign
R5746:Zcchc14 UTSW 8 121604639 unclassified probably benign
R5781:Zcchc14 UTSW 8 121604593 unclassified probably benign
R5897:Zcchc14 UTSW 8 121605160 unclassified probably benign
R5930:Zcchc14 UTSW 8 121611358 intron probably benign
R5963:Zcchc14 UTSW 8 121628623 intron probably benign
R6364:Zcchc14 UTSW 8 121604859 unclassified probably benign
R6562:Zcchc14 UTSW 8 121604103 missense probably damaging 0.99
R6579:Zcchc14 UTSW 8 121604467 intron probably benign
R6592:Zcchc14 UTSW 8 121604639 unclassified probably benign
R6699:Zcchc14 UTSW 8 121608616 unclassified probably benign
R7420:Zcchc14 UTSW 8 121651791 intron probably benign
R7490:Zcchc14 UTSW 8 121605017 missense unknown
R7597:Zcchc14 UTSW 8 121608500 missense unknown
R7758:Zcchc14 UTSW 8 121604689 missense unknown
R7773:Zcchc14 UTSW 8 121651775 missense unknown
R7831:Zcchc14 UTSW 8 121605245 missense not run
R7889:Zcchc14 UTSW 8 121604895 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCGTCTAAAAGCCTTACTTGG -3'
(R):5'- TACCTCTAAGCTCCTGGTGC -3'

Sequencing Primer
(F):5'- TACTTGGCCCCTCTAGGAATGAG -3'
(R):5'- AAGCTCCTGGTGCCACTCAC -3'
Posted On2019-06-26