Incidental Mutation 'R7195:Ptpn9'
ID559864
Institutional Source Beutler Lab
Gene Symbol Ptpn9
Ensembl Gene ENSMUSG00000032290
Gene Nameprotein tyrosine phosphatase, non-receptor type 9
SynonymsMeg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location56994923-57062807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57022249 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 83 (H83Q)
Ref Sequence ENSEMBL: ENSMUSP00000034832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034832] [ENSMUST00000216034]
Predicted Effect probably benign
Transcript: ENSMUST00000034832
AA Change: H83Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034832
Gene: ENSMUSG00000032290
AA Change: H83Q

DomainStartEndE-ValueType
CRAL_TRIO_N 43 68 1.14e0 SMART
SEC14 90 240 7.33e-40 SMART
PTPc 302 576 1.01e-136 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216034
AA Change: H6Q

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain that shares a significant similarity with yeast SEC14, which is a protein that has phosphatidylinositol transfer activity and is required for protein secretion through the Golgi complex in yeast. This PTP was found to be activated by polyphosphoinositide, and is thought to be involved in signaling events regulating phagocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display hemorrhages, craniofacial anomalies, neural tube defects such as exencephaly and meningomyeloceles, cerebral infarctions, abnormal bone development, and >90% late embryonic lethality in addition to severe defectsin T lymphocyte and platelet activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Ptpn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Ptpn9 APN 9 57036703 missense possibly damaging 0.68
IGL01388:Ptpn9 APN 9 57036718 missense probably benign 0.00
IGL01953:Ptpn9 APN 9 57056788 missense possibly damaging 0.69
IGL02525:Ptpn9 APN 9 57036725 nonsense probably null
IGL03294:Ptpn9 APN 9 57027387 missense possibly damaging 0.79
BB009:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
BB019:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
PIT4486001:Ptpn9 UTSW 9 57061003 missense probably damaging 0.99
R0530:Ptpn9 UTSW 9 57061133 missense probably benign
R1617:Ptpn9 UTSW 9 57027408 missense possibly damaging 0.79
R1964:Ptpn9 UTSW 9 57059912 missense probably damaging 1.00
R2426:Ptpn9 UTSW 9 57027428 missense possibly damaging 0.61
R4394:Ptpn9 UTSW 9 57036563 missense possibly damaging 0.91
R4606:Ptpn9 UTSW 9 57022211 missense possibly damaging 0.71
R4658:Ptpn9 UTSW 9 57020037 missense probably benign 0.01
R4660:Ptpn9 UTSW 9 57036498 missense probably benign 0.17
R5141:Ptpn9 UTSW 9 57036676 missense possibly damaging 0.56
R5150:Ptpn9 UTSW 9 57036670 missense probably benign
R5289:Ptpn9 UTSW 9 57060063 critical splice donor site probably null
R5389:Ptpn9 UTSW 9 57056837 intron probably benign
R5422:Ptpn9 UTSW 9 57033157 missense probably damaging 1.00
R5437:Ptpn9 UTSW 9 57020037 missense possibly damaging 0.80
R6075:Ptpn9 UTSW 9 57061146 missense probably benign 0.00
R6084:Ptpn9 UTSW 9 57033163 nonsense probably null
R6481:Ptpn9 UTSW 9 57023040 missense probably damaging 1.00
R7120:Ptpn9 UTSW 9 57059882 missense probably damaging 1.00
R7194:Ptpn9 UTSW 9 57022286 missense probably damaging 1.00
R7349:Ptpn9 UTSW 9 57044376 missense probably benign 0.16
R7439:Ptpn9 UTSW 9 57027433 nonsense probably null
R7441:Ptpn9 UTSW 9 57027433 nonsense probably null
R7801:Ptpn9 UTSW 9 57061013 missense probably benign 0.36
R7879:Ptpn9 UTSW 9 57056726 missense possibly damaging 0.50
R7932:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGCTACAAAGGAATTCACAGTTCAG -3'
(R):5'- CAACCTTTCCCAACATGCTG -3'

Sequencing Primer
(F):5'- AGGAATTCACAGTTCAGTTAGTTG -3'
(R):5'- AAAACTTTGTCTTCTGCTCCATAAC -3'
Posted On2019-06-26