Incidental Mutation 'R7195:Egfr'
ID559870
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Nameepidermal growth factor receptor
Synonymsavian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location16752203-16918158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 16868162 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 228 (P228L)
Ref Sequence ENSEMBL: ENSMUSP00000020329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]
Predicted Effect probably damaging
Transcript: ENSMUST00000020329
AA Change: P228L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: P228L

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102884
AA Change: P228L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: P228L

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16863020 missense probably damaging 1.00
IGL01529:Egfr APN 11 16863014 missense probably benign
IGL01556:Egfr APN 11 16905382 missense probably damaging 1.00
IGL02627:Egfr APN 11 16869346 missense probably damaging 1.00
IGL02862:Egfr APN 11 16883562 missense probably benign 0.25
IGL02945:Egfr APN 11 16752514 missense probably damaging 1.00
IGL02994:Egfr APN 11 16911811 missense probably damaging 1.00
IGL03395:Egfr APN 11 16910261 splice site probably benign
set UTSW 11 16871881 splice site probably benign
Velvet UTSW 11 16904399 missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16910214 missense probably benign 0.00
R0196:Egfr UTSW 11 16911746 missense probably benign 0.02
R0513:Egfr UTSW 11 16872855 missense probably damaging 1.00
R0567:Egfr UTSW 11 16872873 missense probably benign 0.01
R0629:Egfr UTSW 11 16869333 missense probably damaging 1.00
R0961:Egfr UTSW 11 16862964 missense probably damaging 1.00
R1163:Egfr UTSW 11 16883546 missense probably benign 0.02
R1454:Egfr UTSW 11 16889920 missense probably benign
R1456:Egfr UTSW 11 16863065 missense probably benign 0.00
R1503:Egfr UTSW 11 16869301 missense possibly damaging 0.86
R1577:Egfr UTSW 11 16869241 missense probably benign 0.04
R1595:Egfr UTSW 11 16906847 missense probably damaging 0.99
R1699:Egfr UTSW 11 16859019 missense probably benign 0.14
R2172:Egfr UTSW 11 16911562 missense probably benign 0.00
R3690:Egfr UTSW 11 16871881 splice site probably benign
R3922:Egfr UTSW 11 16881495 missense probably damaging 1.00
R4444:Egfr UTSW 11 16871027 missense probably benign 0.00
R4685:Egfr UTSW 11 16858980 missense probably damaging 1.00
R4737:Egfr UTSW 11 16869231 missense probably damaging 0.99
R4814:Egfr UTSW 11 16869354 missense probably damaging 1.00
R4841:Egfr UTSW 11 16911607 missense probably benign 0.05
R4842:Egfr UTSW 11 16911607 missense probably benign 0.05
R4903:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4964:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4985:Egfr UTSW 11 16859029 nonsense probably null
R4998:Egfr UTSW 11 16881493 missense possibly damaging 0.58
R5001:Egfr UTSW 11 16904434 missense probably damaging 0.98
R5304:Egfr UTSW 11 16884260 missense probably benign
R5309:Egfr UTSW 11 16911703 missense probably benign 0.00
R5653:Egfr UTSW 11 16911617 missense probably benign 0.04
R5905:Egfr UTSW 11 16911494 missense probably damaging 1.00
R6051:Egfr UTSW 11 16883607 missense possibly damaging 0.87
R6052:Egfr UTSW 11 16911554 missense probably benign 0.16
R6114:Egfr UTSW 11 16904374 missense possibly damaging 0.46
R6261:Egfr UTSW 11 16889964 missense probably benign 0.11
R6434:Egfr UTSW 11 16869294 missense probably benign 0.25
R6475:Egfr UTSW 11 16891259 missense probably benign
R6799:Egfr UTSW 11 16896952 missense probably damaging 1.00
R7143:Egfr UTSW 11 16871627 missense probably benign 0.20
R7459:Egfr UTSW 11 16896967 missense probably damaging 1.00
R7612:Egfr UTSW 11 16859025 missense possibly damaging 0.74
R7757:Egfr UTSW 11 16889966 missense possibly damaging 0.64
R7763:Egfr UTSW 11 16891266 missense probably damaging 1.00
R8315:Egfr UTSW 11 16875027 missense probably benign 0.08
R8320:Egfr UTSW 11 16891251 missense probably damaging 1.00
Z1177:Egfr UTSW 11 16862954 missense probably benign 0.05
Z1177:Egfr UTSW 11 16869319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCACAAAACCCATGGTTCC -3'
(R):5'- GGTCTTACAGAAGAAGAGCTCCC -3'

Sequencing Primer
(F):5'- AAAACCCATGGTTCCTCCTTTATTTC -3'
(R):5'- AGAAGAAGAGCTCCCTTCATTTCTC -3'
Posted On2019-06-26