Incidental Mutation 'R7195:Suz12'
ID559874
Institutional Source Beutler Lab
Gene Symbol Suz12
Ensembl Gene ENSMUSG00000017548
Gene NameSUZ12 polycomb repressive complex 2 subunit
Synonyms2610028O16Rik, D11Ertd530e
MMRRC Submission
Accession Numbers

Genbank: NM_199196, NM_001163018; MGI: 1261758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location79993106-80034123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80013483 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 239 (F239L)
Ref Sequence ENSEMBL: ENSMUSP00000017692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017692] [ENSMUST00000163272]
Predicted Effect probably damaging
Transcript: ENSMUST00000017692
AA Change: F239L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017692
Gene: ENSMUSG00000017548
AA Change: F239L

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 5e-3 SMART
ZnF_C2H2 450 473 4.45e0 SMART
Pfam:VEFS-Box 548 682 3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126091
SMART Domains Protein: ENSMUSP00000129070
Gene: ENSMUSG00000017548

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163272
AA Change: F216L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126932
Gene: ENSMUSG00000017548
AA Change: F216L

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 6e-3 SMART
ZnF_C2H2 427 450 4.45e0 SMART
Pfam:VEFS-Box 523 660 2.4e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a core component of the polycomb repressive complex 2 (PRC2) that also includes, at least, embryonic ectoderm development protein (EED) and enhancer of zeste homolog 1 or 2 (EZH1 or EZH2). Through the methyltransferase activity of EZH1 or EZH2, the PRC2 complex methylates Lys9 and Lys27 of histone 3 and Lys26 of histone 1, leading to recruitment of the PRC1 complex, histone 2A ubiquitylation and transcriptional repression of the target genes. This gene product is essential for the activity and integrity of the PRC2 complex, and is required for X chromosome inactivation, stem cell maintenance and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice die during early postimplantation stages with failure of embryonic and extraembyronic tissues and organogenesis. Mice heterozygous for a knock-out allele exhibit abnormal brain and spinal cord development with varying penetrance. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(30) Chemically induced(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Suz12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Suz12 APN 11 79999092 missense probably damaging 0.99
IGL00938:Suz12 APN 11 80007569 splice site probably benign
IGL01902:Suz12 APN 11 80025950 missense probably benign 0.04
IGL02998:Suz12 APN 11 80029323 missense probably damaging 1.00
3-1:Suz12 UTSW 11 79999049 intron probably benign
R0317:Suz12 UTSW 11 79999078 missense probably damaging 1.00
R0453:Suz12 UTSW 11 80030033 missense probably damaging 1.00
R1454:Suz12 UTSW 11 80032113 missense probably benign
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1745:Suz12 UTSW 11 80022096 missense probably damaging 0.99
R1868:Suz12 UTSW 11 80013599 splice site probably null
R1957:Suz12 UTSW 11 79999100 missense probably benign 0.01
R2192:Suz12 UTSW 11 80022198 missense probably damaging 1.00
R3003:Suz12 UTSW 11 80019761 missense probably damaging 1.00
R3758:Suz12 UTSW 11 80024942 missense probably benign 0.00
R4017:Suz12 UTSW 11 80013466 missense probably damaging 1.00
R4275:Suz12 UTSW 11 80030053 missense probably damaging 1.00
R4366:Suz12 UTSW 11 80002162 intron probably benign
R4487:Suz12 UTSW 11 80032113 missense probably benign
R4663:Suz12 UTSW 11 80013524 missense probably damaging 1.00
R4730:Suz12 UTSW 11 80002162 intron probably benign
R4959:Suz12 UTSW 11 80029231 missense probably damaging 1.00
R5763:Suz12 UTSW 11 80025308 nonsense probably null
R6238:Suz12 UTSW 11 80002180 intron probably benign
R6379:Suz12 UTSW 11 80015188 missense possibly damaging 0.87
R6880:Suz12 UTSW 11 80002172 nonsense probably null
R7122:Suz12 UTSW 11 79993593 missense probably damaging 0.99
R7343:Suz12 UTSW 11 80019703 missense probably benign 0.34
R7472:Suz12 UTSW 11 80024975 missense probably benign 0.01
X0023:Suz12 UTSW 11 80029240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGTATGTTAGTTTCACATTCC -3'
(R):5'- CTTTGGAAAGAAACAAGGTTTGGTG -3'

Sequencing Primer
(F):5'- ACATTCCATTTTGTACTTGTGGC -3'
(R):5'- TTCCTGGACGAGTTACTC -3'
Posted On2019-06-26