Incidental Mutation 'R7195:Itih4'
ID559881
Institutional Source Beutler Lab
Gene Symbol Itih4
Ensembl Gene ENSMUSG00000021922
Gene Nameinter alpha-trypsin inhibitor, heavy chain 4
SynonymsItih-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30886476-30902353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30899475 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 832 (S832P)
Ref Sequence ENSEMBL: ENSMUSP00000112798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006703] [ENSMUST00000078490] [ENSMUST00000120269] [ENSMUST00000168782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006703
AA Change: S792P

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006703
Gene: ENSMUSG00000021922
AA Change: S792P

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 781 941 2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078490
AA Change: S831P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077580
Gene: ENSMUSG00000021922
AA Change: S831P

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 777 941 2.2e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120269
AA Change: S832P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112798
Gene: ENSMUSG00000021922
AA Change: S832P

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 738 902 6.5e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168782
AA Change: S815P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125920
Gene: ENSMUSG00000021922
AA Change: S815P

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 761 925 2.2e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors with diverse functions as anti-apoptotic and matrix stabilizing molecules during development. This gene is predominantly expressed in the liver and the encoded protein was found to be a plasma kallikrein-sensitive glycoprotein. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal. Surprisingly, IL-6/STAT3 signaling is significantly suppressed in mutant liver tissues but hepatocytes remain well differentiated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
4930563D23Rik C T 16: 92,321,149 V84M probably damaging Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in Itih4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itih4 APN 14 30895469 missense probably damaging 0.97
IGL00776:Itih4 APN 14 30889604 missense probably benign 0.03
IGL01309:Itih4 APN 14 30891749 missense probably damaging 1.00
IGL01433:Itih4 APN 14 30895448 missense probably benign 0.01
IGL01598:Itih4 APN 14 30887817 missense possibly damaging 0.92
IGL02332:Itih4 APN 14 30887860 missense probably damaging 1.00
IGL03075:Itih4 APN 14 30892283 missense probably benign 0.02
IGL03304:Itih4 APN 14 30898049 missense probably damaging 0.98
IGL03353:Itih4 APN 14 30887844 missense probably damaging 1.00
IGL03396:Itih4 APN 14 30887949 missense probably damaging 1.00
PIT4453001:Itih4 UTSW 14 30901170 missense probably benign 0.29
R0304:Itih4 UTSW 14 30890094 splice site probably null
R0477:Itih4 UTSW 14 30889674 missense probably damaging 1.00
R0783:Itih4 UTSW 14 30895423 missense possibly damaging 0.84
R0882:Itih4 UTSW 14 30892274 missense probably damaging 1.00
R1118:Itih4 UTSW 14 30896167 splice site probably benign
R1126:Itih4 UTSW 14 30889961 critical splice donor site probably null
R1238:Itih4 UTSW 14 30887949 missense probably damaging 1.00
R1456:Itih4 UTSW 14 30892653 missense probably benign 0.31
R1573:Itih4 UTSW 14 30897547 missense probably benign 0.00
R1695:Itih4 UTSW 14 30891499 critical splice donor site probably null
R2085:Itih4 UTSW 14 30892323 missense possibly damaging 0.91
R2093:Itih4 UTSW 14 30891737 missense probably damaging 1.00
R2213:Itih4 UTSW 14 30890713 missense probably damaging 0.99
R2249:Itih4 UTSW 14 30899394 nonsense probably null
R2267:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2268:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2508:Itih4 UTSW 14 30895478 missense probably damaging 1.00
R3724:Itih4 UTSW 14 30892584 missense possibly damaging 0.60
R3859:Itih4 UTSW 14 30892329 missense probably damaging 1.00
R4042:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4044:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4246:Itih4 UTSW 14 30891402 missense probably damaging 1.00
R4422:Itih4 UTSW 14 30889864 missense probably damaging 1.00
R4553:Itih4 UTSW 14 30900953 missense probably damaging 1.00
R4581:Itih4 UTSW 14 30900968 missense probably benign 0.01
R4608:Itih4 UTSW 14 30901669 missense probably damaging 1.00
R4609:Itih4 UTSW 14 30901669 missense probably damaging 1.00
R4726:Itih4 UTSW 14 30889835 missense probably damaging 1.00
R4790:Itih4 UTSW 14 30889910 missense probably damaging 1.00
R4975:Itih4 UTSW 14 30892287 missense probably damaging 1.00
R5004:Itih4 UTSW 14 30892672 missense probably damaging 1.00
R5911:Itih4 UTSW 14 30890655 missense possibly damaging 0.90
R6014:Itih4 UTSW 14 30892629 missense probably benign 0.01
R6957:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7012:Itih4 UTSW 14 30890749 missense probably benign 0.16
R7075:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7231:Itih4 UTSW 14 30896614 missense probably benign 0.17
R7509:Itih4 UTSW 14 30895447 missense probably benign 0.08
R7819:Itih4 UTSW 14 30901663 missense probably benign 0.00
R7967:Itih4 UTSW 14 30892413 missense probably damaging 1.00
R8084:Itih4 UTSW 14 30899443 missense possibly damaging 0.95
R8257:Itih4 UTSW 14 30887868 missense possibly damaging 0.93
R8534:Itih4 UTSW 14 30901022 missense probably benign 0.13
R8797:Itih4 UTSW 14 30896572 missense probably benign 0.00
R8886:Itih4 UTSW 14 30895525 nonsense probably null
R9006:Itih4 UTSW 14 30890129 missense probably damaging 1.00
Z1176:Itih4 UTSW 14 30899462 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGCCATTGCTCTGAATTGAC -3'
(R):5'- TAGTGATGAGGTCCAGGTCC -3'

Sequencing Primer
(F):5'- GACTTTGAAATCTCTGGTCTGGCC -3'
(R):5'- GACAGGGCCTCAAGAGCAAC -3'
Posted On2019-06-26