Incidental Mutation 'R7195:4930563D23Rik'
ID559888
Institutional Source Beutler Lab
Gene Symbol 4930563D23Rik
Ensembl Gene ENSMUSG00000051728
Gene NameRIKEN cDNA 4930563D23 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7195 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location92318765-92321441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92321149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 84 (V84M)
Ref Sequence ENSEMBL: ENSMUSP00000049694 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000062638
AA Change: V84M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T C 11: 58,288,416 probably null Het
Abca2 A G 2: 25,442,076 D1400G probably benign Het
Actl11 A T 9: 107,928,870 K131* probably null Het
Adam39 A T 8: 40,824,775 R68* probably null Het
Akap7 A T 10: 25,271,507 N108K probably damaging Het
Arhgef10l C A 4: 140,611,410 A14S probably benign Het
BC067074 A T 13: 113,367,929 D1864V Het
Ccdc141 T G 2: 77,049,583 N632T probably benign Het
Ccm2 T C 11: 6,596,302 S435P probably damaging Het
Cd36 A G 5: 17,814,189 L178P probably damaging Het
Cd7 T C 11: 121,038,249 I59V probably benign Het
Cds2 T A 2: 132,293,284 S32T probably benign Het
Cep19 A G 16: 32,107,086 D104G probably damaging Het
Col1a2 C T 6: 4,510,753 P68S unknown Het
Col20a1 A G 2: 181,007,231 H1011R probably damaging Het
D7Ertd443e A G 7: 134,295,122 V513A probably damaging Het
Egfr C T 11: 16,868,162 P228L probably damaging Het
Fam78b A G 1: 167,078,562 R97G probably damaging Het
Flt1 C T 5: 147,603,576 V768M probably damaging Het
Gdap1l1 A T 2: 163,446,130 N96Y probably damaging Het
Gm7168 T A 17: 13,949,360 Y330N probably benign Het
Hnrnpul1 T C 7: 25,724,778 N683S unknown Het
Ice2 C T 9: 69,428,500 P922S possibly damaging Het
Iglv2 A G 16: 19,260,510 V81A not run Het
Irs1 A G 1: 82,287,456 I1013T probably benign Het
Itih4 T C 14: 30,899,475 S832P probably damaging Het
Klhl1 A T 14: 96,280,077 Y388N probably benign Het
Lrrc37a G A 11: 103,457,775 S2698L unknown Het
Map4k4 T C 1: 40,019,669 Y1008H possibly damaging Het
Mdn1 G T 4: 32,701,823 G1519W probably damaging Het
Mga T A 2: 119,917,328 D653E probably damaging Het
Npas1 T C 7: 16,474,808 E48G probably damaging Het
Nup188 G A 2: 30,341,830 probably null Het
Olfr1215 G A 2: 89,001,731 L186F Het
Olfr33 A G 7: 102,713,666 V249A possibly damaging Het
Olfr399 T A 11: 74,054,397 M121L probably damaging Het
Olfr404-ps1 G T 11: 74,239,568 M1I probably null Het
Olfr544 A T 7: 102,484,367 V251D probably damaging Het
Olfr871 A G 9: 20,212,544 N65S probably damaging Het
Oxct1 T C 15: 4,128,901 V439A probably damaging Het
Pcdhb22 G T 18: 37,519,288 G13W probably damaging Het
Pex11g A G 8: 3,459,237 V230A probably benign Het
Pop1 C T 15: 34,510,379 S439L probably damaging Het
Ptpn9 T A 9: 57,022,249 H83Q probably benign Het
Qrfp C T 2: 31,808,692 R76H probably benign Het
Slc30a3 A G 5: 31,088,795 V197A probably benign Het
Slc8a3 T C 12: 81,314,273 N591D possibly damaging Het
Sp4 G T 12: 118,300,072 Q80K possibly damaging Het
Spock1 C T 13: 57,907,502 G29D possibly damaging Het
Sprr1a G T 3: 92,484,367 P109Q probably damaging Het
Suz12 T A 11: 80,013,483 F239L probably damaging Het
Tbx3 A G 5: 119,675,583 Y248C probably damaging Het
Trabd2b T C 4: 114,409,440 L217P probably damaging Het
Ubxn11 A C 4: 134,126,415 I398L possibly damaging Het
Vmn1r173 T A 7: 23,702,459 S40T probably damaging Het
Vmn2r2 T C 3: 64,116,479 S894G probably benign Het
Vmn2r65 A G 7: 84,943,139 probably null Het
Vps13c G A 9: 67,945,825 G2400D possibly damaging Het
Vps8 T C 16: 21,456,282 Y197H probably damaging Het
Wdr91 T C 6: 34,889,274 N486D possibly damaging Het
Wwp1 A G 4: 19,627,908 I695T possibly damaging Het
Zc3hc1 T C 6: 30,382,548 D133G probably benign Het
Zcchc14 T C 8: 121,608,461 I307V unknown Het
Zfp933 G A 4: 147,826,179 T320I probably benign Het
Other mutations in 4930563D23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:4930563D23Rik APN 16 92321002 missense possibly damaging 0.47
IGL01327:4930563D23Rik APN 16 92320773 missense probably benign 0.10
IGL02812:4930563D23Rik APN 16 92320728 missense probably damaging 0.98
IGL02981:4930563D23Rik APN 16 92320869 missense probably benign 0.05
R0458:4930563D23Rik UTSW 16 92321107 missense probably benign 0.00
R0826:4930563D23Rik UTSW 16 92321187 missense probably benign 0.05
R1456:4930563D23Rik UTSW 16 92320665 missense probably damaging 0.99
R1754:4930563D23Rik UTSW 16 92321031 missense probably damaging 0.98
R2568:4930563D23Rik UTSW 16 92321319 missense probably damaging 1.00
R5916:4930563D23Rik UTSW 16 92320671 missense probably damaging 1.00
R7148:4930563D23Rik UTSW 16 92320987 missense probably benign
R7289:4930563D23Rik UTSW 16 92320822 missense probably damaging 1.00
R7638:4930563D23Rik UTSW 16 92320917 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGCTTGTTGGGACATAGGC -3'
(R):5'- AGTTTGACAGCGCCAAGAG -3'

Sequencing Primer
(F):5'- TTGGGACATAGGCCTTGGCC -3'
(R):5'- GGAGACAGTGCCTTCAGTATC -3'
Posted On2019-06-26