Mutagenetix > Incidental Mutation

Incidental Mutation 'R7195:Pcdhb22'

559890

Institutional Source

Beutler Lab

Gene Symbol

Pcdhb22

Ensembl Gene

ENSMUSG00000073591

Gene Name

protocadherin beta 22

Synonyms

PcdhbV, Pcdhb15

MMRRC Submission

045336-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7195 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37517871-37524479 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 37519288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 13 (G13W)

Ref Sequence

ENSEMBL: ENSMUSP00000095214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]

AlphaFold

Q91XZ8

Predicted Effect

probably benign
Transcript: ENSMUST00000061405

SMART Domains

Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Cadherin_2	30	110	4.2e-30	PFAM
CA	153	238	1.8e-17	SMART
CA	262	343	1.54e-25	SMART
CA	367	448	1.03e-21	SMART
CA	472	558	3.41e-27	SMART
CA	588	669	1.54e-11	SMART
Pfam:Cadherin_C_2	686	769	1.5e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000097609
AA Change: G13W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591
AA Change: G13W

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Cadherin_2	28	110	5.8e-32	PFAM
CA	153	238	3.99e-19	SMART
CA	262	343	2.18e-25	SMART
CA	366	447	1.53e-20	SMART
CA	471	557	3.6e-26	SMART
CA	587	668	5.35e-11	SMART
Pfam:Cadherin_C_2	685	768	4.5e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115661

SMART Domains

Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

Domain	Start	End	E-Value	Type
CA	20	131	5.3e-2	SMART
CA	155	240	1.51e-19	SMART
CA	264	348	7.6e-25	SMART
CA	372	453	1.42e-24	SMART
CA	477	563	1.42e-24	SMART
CA	594	674	4.12e-12	SMART
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cadherin_tail	796	930	3.9e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000192409
AA Change: G270W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591
AA Change: G270W

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Cadherin_2	27	110	2.5e-32	PFAM
CA	153	238	3.99e-19	SMART
CA	262	343	2.18e-25	SMART
CA	366	447	1.53e-20	SMART
CA	471	557	3.6e-26	SMART
CA	587	668	5.35e-11	SMART
transmembrane domain	689	711	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193984

Predicted Effect

probably benign
Transcript: ENSMUST00000194544

SMART Domains

Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

Domain	Start	End	E-Value	Type
Blast:CA	18	66	5e-20	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	T	C	11: 58,288,416		probably null	Het
4930563D23Rik	C	T	16: 92,321,149	V84M	probably damaging	Het
Abca2	A	G	2: 25,442,076	D1400G	probably benign	Het
Actl11	A	T	9: 107,928,870	K131*	probably null	Het
Adam39	A	T	8: 40,824,775	R68*	probably null	Het
Akap7	A	T	10: 25,271,507	N108K	probably damaging	Het
Arhgef10l	C	A	4: 140,611,410	A14S	probably benign	Het
BC067074	A	T	13: 113,367,929	D1864V		Het
Ccdc141	T	G	2: 77,049,583	N632T	probably benign	Het
Ccm2	T	C	11: 6,596,302	S435P	probably damaging	Het
Cd36	A	G	5: 17,814,189	L178P	probably damaging	Het
Cd7	T	C	11: 121,038,249	I59V	probably benign	Het
Cds2	T	A	2: 132,293,284	S32T	probably benign	Het
Cep19	A	G	16: 32,107,086	D104G	probably damaging	Het
Col1a2	C	T	6: 4,510,753	P68S	unknown	Het
Col20a1	A	G	2: 181,007,231	H1011R	probably damaging	Het
D7Ertd443e	A	G	7: 134,295,122	V513A	probably damaging	Het
Egfr	C	T	11: 16,868,162	P228L	probably damaging	Het
Fam78b	A	G	1: 167,078,562	R97G	probably damaging	Het
Flt1	C	T	5: 147,603,576	V768M	probably damaging	Het
Gdap1l1	A	T	2: 163,446,130	N96Y	probably damaging	Het
Gm7168	T	A	17: 13,949,360	Y330N	probably benign	Het
Hnrnpul1	T	C	7: 25,724,778	N683S	unknown	Het
Ice2	C	T	9: 69,428,500	P922S	possibly damaging	Het
Iglv2	A	G	16: 19,260,510	V81A	not run	Het
Irs1	A	G	1: 82,287,456	I1013T	probably benign	Het
Itih4	T	C	14: 30,899,475	S832P	probably damaging	Het
Klhl1	A	T	14: 96,280,077	Y388N	probably benign	Het
Lrrc37a	G	A	11: 103,457,775	S2698L	unknown	Het
Map4k4	T	C	1: 40,019,669	Y1008H	possibly damaging	Het
Mdn1	G	T	4: 32,701,823	G1519W	probably damaging	Het
Mga	T	A	2: 119,917,328	D653E	probably damaging	Het
Npas1	T	C	7: 16,474,808	E48G	probably damaging	Het
Nup188	G	A	2: 30,341,830		probably null	Het
Olfr1215	G	A	2: 89,001,731	L186F		Het
Olfr33	A	G	7: 102,713,666	V249A	possibly damaging	Het
Olfr399	T	A	11: 74,054,397	M121L	probably damaging	Het
Olfr404-ps1	G	T	11: 74,239,568	M1I	probably null	Het
Olfr544	A	T	7: 102,484,367	V251D	probably damaging	Het
Olfr871	A	G	9: 20,212,544	N65S	probably damaging	Het
Oxct1	T	C	15: 4,128,901	V439A	probably damaging	Het
Pex11g	A	G	8: 3,459,237	V230A	probably benign	Het
Pop1	C	T	15: 34,510,379	S439L	probably damaging	Het
Ptpn9	T	A	9: 57,022,249	H83Q	probably benign	Het
Qrfp	C	T	2: 31,808,692	R76H	probably benign	Het
Slc30a3	A	G	5: 31,088,795	V197A	probably benign	Het
Slc8a3	T	C	12: 81,314,273	N591D	possibly damaging	Het
Sp4	G	T	12: 118,300,072	Q80K	possibly damaging	Het
Spock1	C	T	13: 57,907,502	G29D	possibly damaging	Het
Sprr1a	G	T	3: 92,484,367	P109Q	probably damaging	Het
Suz12	T	A	11: 80,013,483	F239L	probably damaging	Het
Tbx3	A	G	5: 119,675,583	Y248C	probably damaging	Het
Trabd2b	T	C	4: 114,409,440	L217P	probably damaging	Het
Ubxn11	A	C	4: 134,126,415	I398L	possibly damaging	Het
Vmn1r173	T	A	7: 23,702,459	S40T	probably damaging	Het
Vmn2r2	T	C	3: 64,116,479	S894G	probably benign	Het
Vmn2r65	A	G	7: 84,943,139		probably null	Het
Vps13c	G	A	9: 67,945,825	G2400D	possibly damaging	Het
Vps8	T	C	16: 21,456,282	Y197H	probably damaging	Het
Wdr91	T	C	6: 34,889,274	N486D	possibly damaging	Het
Wwp1	A	G	4: 19,627,908	I695T	possibly damaging	Het
Zc3hc1	T	C	6: 30,382,548	D133G	probably benign	Het
Zcchc14	T	C	8: 121,608,461	I307V	unknown	Het
Zfp933	G	A	4: 147,826,179	T320I	probably benign	Het

Other mutations in Pcdhb22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Pcdhb22	APN	18	37520132	missense	probably damaging	1.00
IGL00775:Pcdhb22	APN	18	37519742	missense	probably benign	0.09
IGL01414:Pcdhb22	APN	18	37519496	missense	probably damaging	1.00
IGL01819:Pcdhb22	APN	18	37519921	missense	probably damaging	1.00
IGL02232:Pcdhb22	APN	18	37520549	missense	probably damaging	1.00
IGL03226:Pcdhb22	APN	18	37518956	missense	probably damaging	1.00
chipper	UTSW	18	37519102	missense	probably benign	0.39
timber	UTSW	18	37519147	missense	probably damaging	1.00
R0071:Pcdhb22	UTSW	18	37520078	missense	probably damaging	1.00
R0363:Pcdhb22	UTSW	18	37519160	missense	probably benign	0.01
R0454:Pcdhb22	UTSW	18	37518872	missense	probably damaging	0.99
R0624:Pcdhb22	UTSW	18	37518727	missense	probably benign	0.00
R0707:Pcdhb22	UTSW	18	37518851	missense	probably damaging	1.00
R0918:Pcdhb22	UTSW	18	37520014	missense	probably damaging	1.00
R1112:Pcdhb22	UTSW	18	37519768	missense	possibly damaging	0.61
R1299:Pcdhb22	UTSW	18	37520590	missense	probably damaging	0.99
R1351:Pcdhb22	UTSW	18	37518574	missense	probably benign	0.10
R1488:Pcdhb22	UTSW	18	37519888	missense	possibly damaging	0.79
R1595:Pcdhb22	UTSW	18	37520453	missense	probably damaging	1.00
R1709:Pcdhb22	UTSW	18	37518500	missense	probably benign	0.31
R1725:Pcdhb22	UTSW	18	37520188	missense	probably benign	0.04
R1869:Pcdhb22	UTSW	18	37519147	missense	probably damaging	1.00
R1871:Pcdhb22	UTSW	18	37519147	missense	probably damaging	1.00
R1891:Pcdhb22	UTSW	18	37519304	missense	probably damaging	0.97
R4523:Pcdhb22	UTSW	18	37520421	missense	probably benign	0.05
R4825:Pcdhb22	UTSW	18	37520660	missense	possibly damaging	0.80
R4831:Pcdhb22	UTSW	18	37520562	missense	probably damaging	1.00
R4851:Pcdhb22	UTSW	18	37519034	missense	possibly damaging	0.89
R4978:Pcdhb22	UTSW	18	37518601	missense	probably benign	0.16
R5047:Pcdhb22	UTSW	18	37519126	missense	probably damaging	1.00
R5061:Pcdhb22	UTSW	18	37519126	missense	probably damaging	1.00
R5063:Pcdhb22	UTSW	18	37519126	missense	probably damaging	1.00
R5467:Pcdhb22	UTSW	18	37520135	missense	probably benign	0.02
R6005:Pcdhb22	UTSW	18	37519736	missense	possibly damaging	0.75
R6375:Pcdhb22	UTSW	18	37518304	intron	probably benign
R6418:Pcdhb22	UTSW	18	37519906	missense	possibly damaging	0.88
R6447:Pcdhb22	UTSW	18	37520216	missense	possibly damaging	0.91
R6748:Pcdhb22	UTSW	18	37518746	missense	probably damaging	0.99
R7243:Pcdhb22	UTSW	18	37520632	missense	probably benign	0.00
R7354:Pcdhb22	UTSW	18	37520258	missense	probably damaging	1.00
R7503:Pcdhb22	UTSW	18	37519102	missense	probably benign	0.39
R7765:Pcdhb22	UTSW	18	37519105	missense	probably damaging	0.99
R8201:Pcdhb22	UTSW	18	37518465	intron	probably benign
R8976:Pcdhb22	UTSW	18	37518343	intron	probably benign
R9059:Pcdhb22	UTSW	18	37519669	missense	probably damaging	1.00
R9072:Pcdhb22	UTSW	18	37518760	missense	probably damaging	1.00
R9082:Pcdhb22	UTSW	18	37519994	missense	probably damaging	1.00
R9299:Pcdhb22	UTSW	18	37518832	nonsense	probably null
R9725:Pcdhb22	UTSW	18	37519741	missense	probably damaging	0.99
R9796:Pcdhb22	UTSW	18	37519351	missense	possibly damaging	0.79
X0027:Pcdhb22	UTSW	18	37520851	missense	probably benign
Z1088:Pcdhb22	UTSW	18	37519345	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- TTAACTCTGACAGCGCTAGATG -3'
(R):5'- TATCGTTGACATCCACCACC -3'

Sequencing Primer
(F):5'- GCTAGATGGCGGTTCTCC -3'
(R):5'- CCTGAATAGAAACAGAGCATTTTCC -3'

Posted On

2019-06-26