Incidental Mutation 'R7196:Nebl'
ID559897
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7196 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17452518 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 77 (V77E)
Ref Sequence ENSEMBL: ENSMUSP00000118525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000131957] [ENSMUST00000132418] [ENSMUST00000145492]
Predicted Effect probably benign
Transcript: ENSMUST00000028080
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124270
AA Change: V77E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: V77E

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131957
AA Change: V77E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118525
Gene: ENSMUSG00000053702
AA Change: V77E

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
NEBU 427 457 4.92e-6 SMART
NEBU 464 494 2.33e-7 SMART
NEBU 501 525 1.02e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132418
AA Change: V77E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122024
Gene: ENSMUSG00000053702
AA Change: V77E

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 4.78e-4 SMART
NEBU 427 450 6.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145492
AA Change: V77E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121313
Gene: ENSMUSG00000053702
AA Change: V77E

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
Meta Mutation Damage Score 0.7326 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (94/95)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
4921504E06Rik A C 2: 19,493,995 S396A probably benign Het
Actr6 C A 10: 89,714,922 V337F possibly damaging Het
Agtpbp1 T C 13: 59,533,180 T73A possibly damaging Het
AI182371 A T 2: 35,086,429 probably null Het
Apob A G 12: 7,983,893 E202G possibly damaging Het
Asb4 A T 6: 5,423,356 M168L probably benign Het
AU018091 T C 7: 3,163,958 Y152C probably damaging Het
Casp3 G A 8: 46,635,463 G132R possibly damaging Het
Cbfa2t3 C A 8: 122,638,990 A229S probably benign Het
Cdh23 A T 10: 60,307,980 Y2949N probably damaging Het
Ceacam3 T C 7: 17,154,956 Y217H Het
Cldn5 A T 16: 18,776,880 probably benign Het
Cltc T C 11: 86,706,831 D1093G probably damaging Het
Cnn3 G A 3: 121,454,788 probably null Het
Col4a2 A G 8: 11,398,693 Y71C probably damaging Het
Csf1 T C 3: 107,753,898 D77G possibly damaging Het
Cyp2j7 T A 4: 96,215,414 T295S probably benign Het
Dnah7a A T 1: 53,684,841 M133K probably benign Het
Dock5 G A 14: 67,756,470 P1852L probably damaging Het
Dpysl3 T A 18: 43,329,845 D489V probably damaging Het
Dsg4 T C 18: 20,466,480 Y718H probably damaging Het
Dync2h1 G A 9: 7,147,715 Q972* probably null Het
Epn1 G A 7: 5,093,381 D225N possibly damaging Het
Esp4 A G 17: 40,602,365 E41G probably benign Het
Fam171a2 T C 11: 102,438,346 D529G probably benign Het
Fbxl13 A T 5: 21,486,303 I694N probably damaging Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Galnt3 A G 2: 66,090,924 Y533H probably damaging Het
Gja5 C A 3: 97,051,106 R160S probably damaging Het
Gm12353 A T 4: 19,608,938 D7V unknown Het
Gm17669 T C 18: 67,562,502 F39S probably damaging Het
Gm7145 T A 1: 117,986,061 N224K possibly damaging Het
Gpd1 G T 15: 99,722,055 G245C probably benign Het
Gpr4 G A 7: 19,223,164 G337D probably benign Het
Hgd G A 16: 37,588,716 C14Y probably benign Het
Ibtk A T 9: 85,743,656 S14T probably damaging Het
Ifi205 G T 1: 174,026,543 N181K probably damaging Het
Inppl1 G A 7: 101,828,786 A673V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Jrkl G T 9: 13,244,157 P500T probably benign Het
Kcnq1 G A 7: 143,358,741 V515I possibly damaging Het
Kifc3 A G 8: 95,106,611 V453A probably benign Het
Krt10 C T 11: 99,387,545 E263K probably damaging Het
Lingo1 A T 9: 56,620,619 F235I probably damaging Het
Lmo7 T A 14: 101,896,500 D660E possibly damaging Het
Magi3 A C 3: 104,049,168 C661W probably benign Het
Mmp1a C T 9: 7,476,017 Q428* probably null Het
Msrb1 A T 17: 24,739,582 T47S probably benign Het
Naip6 A T 13: 100,300,158 I619K probably benign Het
Ndfip2 T C 14: 105,298,038 S253P probably damaging Het
Nit1 T C 1: 171,344,435 E65G probably benign Het
Ntn4 C T 10: 93,733,714 H430Y probably benign Het
Nxpe5 A T 5: 138,239,324 I49F probably benign Het
Olfr1299 T G 2: 111,664,697 L157W probably damaging Het
Olfr18 A G 9: 20,314,198 Y241H probably benign Het
Olfr24 A T 9: 18,755,590 L15* probably null Het
Olfr310 A T 7: 86,269,441 M116K probably damaging Het
Olfr382 A G 11: 73,517,131 Y23H probably benign Het
Olfr605 A T 7: 103,442,997 M42K probably benign Het
Olfr714 A G 7: 107,074,728 N300S probably benign Het
Olfr95 A G 17: 37,211,193 I220T probably damaging Het
Oxct2a T A 4: 123,323,372 N72I probably damaging Het
Pappa G A 4: 65,323,891 probably null Het
Pcnx G A 12: 81,995,538 R34H possibly damaging Het
Plekha5 G T 6: 140,543,922 V236L possibly damaging Het
Prdm1 A G 10: 44,456,992 S44P probably benign Het
Prss46 T A 9: 110,851,465 L226Q probably benign Het
Prss47 C A 13: 65,044,826 W380C probably benign Het
Ptch2 T G 4: 117,114,749 V1156G probably benign Het
Rab3gap2 T C 1: 185,281,667 F1190S probably damaging Het
Raver2 T G 4: 101,102,859 Y179D probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Ripor2 T G 13: 24,704,825 I629S possibly damaging Het
Robo4 T A 9: 37,402,705 M84K possibly damaging Het
Rps6ka5 A T 12: 100,595,864 S252T possibly damaging Het
Rtl1 C T 12: 109,592,787 V873M possibly damaging Het
Sla T A 15: 66,831,571 R4W probably benign Het
Smco1 A G 16: 32,273,802 D97G probably damaging Het
Srgap1 T C 10: 121,840,848 T414A probably benign Het
Syt14 A G 1: 193,035,628 I3T probably benign Het
Tnpo2 G A 8: 85,047,137 V303M possibly damaging Het
Tstd2 A C 4: 46,119,955 S332R probably damaging Het
Ttn C A 2: 76,752,042 A22836S possibly damaging Het
Ufl1 A G 4: 25,250,669 V728A probably benign Het
Usp33 A T 3: 152,384,191 K789N possibly damaging Het
Usp54 T A 14: 20,588,370 Q214L probably damaging Het
Vmn2r7 T G 3: 64,715,777 N374T probably benign Het
Zbtb7a T A 10: 81,144,600 N209K probably damaging Het
Zc3hav1 A G 6: 38,329,272 V615A probably benign Het
Zdhhc20 A G 14: 57,873,891 probably null Het
Zfp90 G T 8: 106,425,148 V498L probably damaging Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
BB008:Nebl UTSW 2 17376622 critical splice donor site probably null
BB018:Nebl UTSW 2 17376622 critical splice donor site probably null
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 splice site probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
R7671:Nebl UTSW 2 17390916 nonsense probably null
R7728:Nebl UTSW 2 17370514 missense
R7931:Nebl UTSW 2 17376622 critical splice donor site probably null
R8007:Nebl UTSW 2 17370489 missense
R8048:Nebl UTSW 2 17424522 missense probably benign 0.12
R8118:Nebl UTSW 2 17379820 missense possibly damaging 0.48
R8317:Nebl UTSW 2 17350757 missense possibly damaging 0.71
R8349:Nebl UTSW 2 17413782 missense probably damaging 0.98
R8360:Nebl UTSW 2 17460487 missense probably benign 0.04
R8392:Nebl UTSW 2 17452552 missense probably benign 0.36
R8449:Nebl UTSW 2 17413782 missense probably damaging 0.98
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGTTTGCACATATTAACTTGG -3'
(R):5'- ACCTCAGAAATGGCTGCTTGG -3'

Sequencing Primer
(F):5'- GTGGATATGATCAGTATTTAGTG -3'
(R):5'- GTCAGTCTTCACTTCAACAACTGGG -3'
Posted On2019-06-26