Incidental Mutation 'R0591:Rap1b'
ID55990
Institutional Source Beutler Lab
Gene Symbol Rap1b
Ensembl Gene ENSMUSG00000052681
Gene NameRAS related protein 1b
Synonyms
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R0591 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117813871-117846035 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 117818617 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064667] [ENSMUST00000220214]
Predicted Effect probably benign
Transcript: ENSMUST00000064667
SMART Domains Protein: ENSMUSP00000066238
Gene: ENSMUSG00000052681

DomainStartEndE-ValueType
RAS 1 168 2.4e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220214
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and perinatal lethality, abdominal, cranial, and hepatic bleeding in mice that die in utero, reduced platelet aggregation, and decreased thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Rap1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Rap1b APN 10 117822860 missense probably damaging 1.00
IGL02539:Rap1b APN 10 117822804 missense possibly damaging 0.82
IGL03286:Rap1b APN 10 117818575 nonsense probably null
R1939:Rap1b UTSW 10 117818586 missense probably damaging 1.00
R2509:Rap1b UTSW 10 117818539 missense probably damaging 0.98
R2902:Rap1b UTSW 10 117824602 missense probably damaging 1.00
R4825:Rap1b UTSW 10 117818582 missense probably benign 0.04
R5131:Rap1b UTSW 10 117824611 missense probably damaging 0.96
R6084:Rap1b UTSW 10 117824611 missense probably damaging 0.96
R6186:Rap1b UTSW 10 117820552 missense probably damaging 1.00
R6737:Rap1b UTSW 10 117822808 missense probably damaging 0.97
R7026:Rap1b UTSW 10 117818479 missense probably benign 0.01
R7530:Rap1b UTSW 10 117817452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGATGCTGCACTGAGCCTAAGAAG -3'
(R):5'- CAAACGTGAAGTTGGTTCACACCC -3'

Sequencing Primer
(F):5'- TGCACTGAGCCTAAGAAGCTATTC -3'
(R):5'- GTGAAGTTGGTTCACACCCTTAAAC -3'
Posted On2013-07-11