Incidental Mutation 'R7196:Magi3'
ID559905
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms4732496O19Rik, 6530407C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R7196 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location104013259-104220374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104049168 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 661 (C661W)
Ref Sequence ENSEMBL: ENSMUSP00000067932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
Predicted Effect probably benign
Transcript: ENSMUST00000064371
AA Change: C661W

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: C661W

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121198
AA Change: C661W

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: C661W

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122303
AA Change: C661W

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: C661W

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (94/95)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
4921504E06Rik A C 2: 19,493,995 S396A probably benign Het
Actr6 C A 10: 89,714,922 V337F possibly damaging Het
Agtpbp1 T C 13: 59,533,180 T73A possibly damaging Het
AI182371 A T 2: 35,086,429 probably null Het
Apob A G 12: 7,983,893 E202G possibly damaging Het
Asb4 A T 6: 5,423,356 M168L probably benign Het
AU018091 T C 7: 3,163,958 Y152C probably damaging Het
Casp3 G A 8: 46,635,463 G132R possibly damaging Het
Cbfa2t3 C A 8: 122,638,990 A229S probably benign Het
Cdh23 A T 10: 60,307,980 Y2949N probably damaging Het
Ceacam3 T C 7: 17,154,956 Y217H Het
Cldn5 A T 16: 18,776,880 probably benign Het
Cltc T C 11: 86,706,831 D1093G probably damaging Het
Cnn3 G A 3: 121,454,788 probably null Het
Col4a2 A G 8: 11,398,693 Y71C probably damaging Het
Csf1 T C 3: 107,753,898 D77G possibly damaging Het
Cyp2j7 T A 4: 96,215,414 T295S probably benign Het
Dnah7a A T 1: 53,684,841 M133K probably benign Het
Dock5 G A 14: 67,756,470 P1852L probably damaging Het
Dpysl3 T A 18: 43,329,845 D489V probably damaging Het
Dsg4 T C 18: 20,466,480 Y718H probably damaging Het
Dync2h1 G A 9: 7,147,715 Q972* probably null Het
Epn1 G A 7: 5,093,381 D225N possibly damaging Het
Esp4 A G 17: 40,602,365 E41G probably benign Het
Fam171a2 T C 11: 102,438,346 D529G probably benign Het
Fbxl13 A T 5: 21,486,303 I694N probably damaging Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Galnt3 A G 2: 66,090,924 Y533H probably damaging Het
Gja5 C A 3: 97,051,106 R160S probably damaging Het
Gm12353 A T 4: 19,608,938 D7V unknown Het
Gm17669 T C 18: 67,562,502 F39S probably damaging Het
Gm7145 T A 1: 117,986,061 N224K possibly damaging Het
Gpd1 G T 15: 99,722,055 G245C probably benign Het
Gpr4 G A 7: 19,223,164 G337D probably benign Het
Hgd G A 16: 37,588,716 C14Y probably benign Het
Ibtk A T 9: 85,743,656 S14T probably damaging Het
Ifi205 G T 1: 174,026,543 N181K probably damaging Het
Inppl1 G A 7: 101,828,786 A673V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Jrkl G T 9: 13,244,157 P500T probably benign Het
Kcnq1 G A 7: 143,358,741 V515I possibly damaging Het
Kifc3 A G 8: 95,106,611 V453A probably benign Het
Krt10 C T 11: 99,387,545 E263K probably damaging Het
Lingo1 A T 9: 56,620,619 F235I probably damaging Het
Lmo7 T A 14: 101,896,500 D660E possibly damaging Het
Mmp1a C T 9: 7,476,017 Q428* probably null Het
Msrb1 A T 17: 24,739,582 T47S probably benign Het
Naip6 A T 13: 100,300,158 I619K probably benign Het
Ndfip2 T C 14: 105,298,038 S253P probably damaging Het
Nebl A T 2: 17,452,518 V77E probably damaging Het
Nit1 T C 1: 171,344,435 E65G probably benign Het
Ntn4 C T 10: 93,733,714 H430Y probably benign Het
Nxpe5 A T 5: 138,239,324 I49F probably benign Het
Olfr1299 T G 2: 111,664,697 L157W probably damaging Het
Olfr18 A G 9: 20,314,198 Y241H probably benign Het
Olfr24 A T 9: 18,755,590 L15* probably null Het
Olfr310 A T 7: 86,269,441 M116K probably damaging Het
Olfr382 A G 11: 73,517,131 Y23H probably benign Het
Olfr605 A T 7: 103,442,997 M42K probably benign Het
Olfr714 A G 7: 107,074,728 N300S probably benign Het
Olfr95 A G 17: 37,211,193 I220T probably damaging Het
Oxct2a T A 4: 123,323,372 N72I probably damaging Het
Pappa G A 4: 65,323,891 probably null Het
Pcnx G A 12: 81,995,538 R34H possibly damaging Het
Plekha5 G T 6: 140,543,922 V236L possibly damaging Het
Prdm1 A G 10: 44,456,992 S44P probably benign Het
Prss46 T A 9: 110,851,465 L226Q probably benign Het
Prss47 C A 13: 65,044,826 W380C probably benign Het
Ptch2 T G 4: 117,114,749 V1156G probably benign Het
Rab3gap2 T C 1: 185,281,667 F1190S probably damaging Het
Raver2 T G 4: 101,102,859 Y179D probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Ripor2 T G 13: 24,704,825 I629S possibly damaging Het
Robo4 T A 9: 37,402,705 M84K possibly damaging Het
Rps6ka5 A T 12: 100,595,864 S252T possibly damaging Het
Rtl1 C T 12: 109,592,787 V873M possibly damaging Het
Sla T A 15: 66,831,571 R4W probably benign Het
Smco1 A G 16: 32,273,802 D97G probably damaging Het
Srgap1 T C 10: 121,840,848 T414A probably benign Het
Syt14 A G 1: 193,035,628 I3T probably benign Het
Tnpo2 G A 8: 85,047,137 V303M possibly damaging Het
Tstd2 A C 4: 46,119,955 S332R probably damaging Het
Ttn C A 2: 76,752,042 A22836S possibly damaging Het
Ufl1 A G 4: 25,250,669 V728A probably benign Het
Usp33 A T 3: 152,384,191 K789N possibly damaging Het
Usp54 T A 14: 20,588,370 Q214L probably damaging Het
Vmn2r7 T G 3: 64,715,777 N374T probably benign Het
Zbtb7a T A 10: 81,144,600 N209K probably damaging Het
Zc3hav1 A G 6: 38,329,272 V615A probably benign Het
Zdhhc20 A G 14: 57,873,891 probably null Het
Zfp90 G T 8: 106,425,148 V498L probably damaging Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 104054352 missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 104015526 missense probably benign 0.05
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0608:Magi3 UTSW 3 104017557 missense probably damaging 1.00
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1256:Magi3 UTSW 3 104027810 missense probably benign 0.08
R1391:Magi3 UTSW 3 104015058 nonsense probably null
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2151:Magi3 UTSW 3 104085238 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5160:Magi3 UTSW 3 104027908 missense possibly damaging 0.46
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5509:Magi3 UTSW 3 104015502 missense probably benign 0.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6358:Magi3 UTSW 3 104050952 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 splice site probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
R7011:Magi3 UTSW 3 104105754 missense probably damaging 1.00
R7039:Magi3 UTSW 3 104051383 missense probably damaging 1.00
R7237:Magi3 UTSW 3 104027911 missense probably damaging 1.00
R7285:Magi3 UTSW 3 104034114 missense probably benign 0.00
R7709:Magi3 UTSW 3 104034038 missense probably damaging 1.00
R7724:Magi3 UTSW 3 104015927 missense probably benign 0.04
R7797:Magi3 UTSW 3 104051302 missense probably damaging 1.00
R7950:Magi3 UTSW 3 104016689 missense probably damaging 1.00
R8140:Magi3 UTSW 3 104034086 missense probably damaging 1.00
R8204:Magi3 UTSW 3 104051186 missense probably benign
R8229:Magi3 UTSW 3 104015701 missense possibly damaging 0.79
R8229:Magi3 UTSW 3 104015702 missense probably benign 0.00
R8260:Magi3 UTSW 3 104015309 missense probably benign 0.01
R8348:Magi3 UTSW 3 104051215 missense probably damaging 1.00
R8368:Magi3 UTSW 3 104095063 critical splice donor site probably null
R8543:Magi3 UTSW 3 104219668 missense probably damaging 0.98
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCACAGACTTCAAAGGGAG -3'
(R):5'- CTGTTTCTGTGATTTAAGGAACCTC -3'

Sequencing Primer
(F):5'- AAGGGAGTTTCCTATCAATACCTGGG -3'
(R):5'- GCATTTATGCCTCTGGAG -3'
Posted On2019-06-26