Incidental Mutation 'R7196:Col4a2'
ID559929
Institutional Source Beutler Lab
Gene Symbol Col4a2
Ensembl Gene ENSMUSG00000031503
Gene Namecollagen, type IV, alpha 2
SynonymsCol4a-2
MMRRC Submission
Accession Numbers

Genbank: NM_009932

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7196 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location11312805-11449287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11398693 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 71 (Y71C)
Ref Sequence ENSEMBL: ENSMUSP00000033899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033899]
Predicted Effect probably damaging
Transcript: ENSMUST00000033899
AA Change: Y71C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503
AA Change: Y71C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 56 119 1.2e-10 PFAM
Pfam:Collagen 112 174 3.9e-8 PFAM
low complexity region 193 229 N/A INTRINSIC
Pfam:Collagen 289 348 1.3e-10 PFAM
low complexity region 370 389 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
Pfam:Collagen 488 546 2e-10 PFAM
Pfam:Collagen 590 655 4.5e-9 PFAM
low complexity region 665 673 N/A INTRINSIC
Pfam:Collagen 674 731 3.5e-10 PFAM
Pfam:Collagen 714 775 4.3e-10 PFAM
Pfam:Collagen 773 831 1.5e-10 PFAM
Pfam:Collagen 861 935 8.1e-10 PFAM
Pfam:Collagen 915 976 1.1e-9 PFAM
Pfam:Collagen 978 1038 2.6e-8 PFAM
Pfam:Collagen 1027 1091 1.7e-10 PFAM
Pfam:Collagen 1094 1155 5.5e-11 PFAM
Pfam:Collagen 1147 1211 1e-10 PFAM
Pfam:Collagen 1271 1340 2.1e-8 PFAM
Pfam:Collagen 1330 1392 7.1e-10 PFAM
C4 1484 1591 7.85e-59 SMART
C4 1592 1706 7.65e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
4921504E06Rik A C 2: 19,493,995 S396A probably benign Het
Actr6 C A 10: 89,714,922 V337F possibly damaging Het
Agtpbp1 T C 13: 59,533,180 T73A possibly damaging Het
AI182371 A T 2: 35,086,429 probably null Het
Apob A G 12: 7,983,893 E202G possibly damaging Het
Asb4 A T 6: 5,423,356 M168L probably benign Het
AU018091 T C 7: 3,163,958 Y152C probably damaging Het
Casp3 G A 8: 46,635,463 G132R possibly damaging Het
Cbfa2t3 C A 8: 122,638,990 A229S probably benign Het
Cdh23 A T 10: 60,307,980 Y2949N probably damaging Het
Ceacam3 T C 7: 17,154,956 Y217H Het
Cldn5 A T 16: 18,776,880 probably benign Het
Cltc T C 11: 86,706,831 D1093G probably damaging Het
Cnn3 G A 3: 121,454,788 probably null Het
Csf1 T C 3: 107,753,898 D77G possibly damaging Het
Cyp2j7 T A 4: 96,215,414 T295S probably benign Het
Dnah7a A T 1: 53,684,841 M133K probably benign Het
Dock5 G A 14: 67,756,470 P1852L probably damaging Het
Dpysl3 T A 18: 43,329,845 D489V probably damaging Het
Dsg4 T C 18: 20,466,480 Y718H probably damaging Het
Dync2h1 G A 9: 7,147,715 Q972* probably null Het
Epn1 G A 7: 5,093,381 D225N possibly damaging Het
Esp4 A G 17: 40,602,365 E41G probably benign Het
Fam171a2 T C 11: 102,438,346 D529G probably benign Het
Fbxl13 A T 5: 21,486,303 I694N probably damaging Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Galnt3 A G 2: 66,090,924 Y533H probably damaging Het
Gja5 C A 3: 97,051,106 R160S probably damaging Het
Gm12353 A T 4: 19,608,938 D7V unknown Het
Gm17669 T C 18: 67,562,502 F39S probably damaging Het
Gm7145 T A 1: 117,986,061 N224K possibly damaging Het
Gpd1 G T 15: 99,722,055 G245C probably benign Het
Gpr4 G A 7: 19,223,164 G337D probably benign Het
Hgd G A 16: 37,588,716 C14Y probably benign Het
Ibtk A T 9: 85,743,656 S14T probably damaging Het
Ifi205 G T 1: 174,026,543 N181K probably damaging Het
Inppl1 G A 7: 101,828,786 A673V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Jrkl G T 9: 13,244,157 P500T probably benign Het
Kcnq1 G A 7: 143,358,741 V515I possibly damaging Het
Kifc3 A G 8: 95,106,611 V453A probably benign Het
Krt10 C T 11: 99,387,545 E263K probably damaging Het
Lingo1 A T 9: 56,620,619 F235I probably damaging Het
Lmo7 T A 14: 101,896,500 D660E possibly damaging Het
Magi3 A C 3: 104,049,168 C661W probably benign Het
Mmp1a C T 9: 7,476,017 Q428* probably null Het
Msrb1 A T 17: 24,739,582 T47S probably benign Het
Naip6 A T 13: 100,300,158 I619K probably benign Het
Ndfip2 T C 14: 105,298,038 S253P probably damaging Het
Nebl A T 2: 17,452,518 V77E probably damaging Het
Nit1 T C 1: 171,344,435 E65G probably benign Het
Ntn4 C T 10: 93,733,714 H430Y probably benign Het
Nxpe5 A T 5: 138,239,324 I49F probably benign Het
Olfr1299 T G 2: 111,664,697 L157W probably damaging Het
Olfr18 A G 9: 20,314,198 Y241H probably benign Het
Olfr24 A T 9: 18,755,590 L15* probably null Het
Olfr310 A T 7: 86,269,441 M116K probably damaging Het
Olfr382 A G 11: 73,517,131 Y23H probably benign Het
Olfr605 A T 7: 103,442,997 M42K probably benign Het
Olfr714 A G 7: 107,074,728 N300S probably benign Het
Olfr95 A G 17: 37,211,193 I220T probably damaging Het
Oxct2a T A 4: 123,323,372 N72I probably damaging Het
Pappa G A 4: 65,323,891 probably null Het
Pcnx G A 12: 81,995,538 R34H possibly damaging Het
Plekha5 G T 6: 140,543,922 V236L possibly damaging Het
Prdm1 A G 10: 44,456,992 S44P probably benign Het
Prss46 T A 9: 110,851,465 L226Q probably benign Het
Prss47 C A 13: 65,044,826 W380C probably benign Het
Ptch2 T G 4: 117,114,749 V1156G probably benign Het
Rab3gap2 T C 1: 185,281,667 F1190S probably damaging Het
Raver2 T G 4: 101,102,859 Y179D probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Ripor2 T G 13: 24,704,825 I629S possibly damaging Het
Robo4 T A 9: 37,402,705 M84K possibly damaging Het
Rps6ka5 A T 12: 100,595,864 S252T possibly damaging Het
Rtl1 C T 12: 109,592,787 V873M possibly damaging Het
Sla T A 15: 66,831,571 R4W probably benign Het
Smco1 A G 16: 32,273,802 D97G probably damaging Het
Srgap1 T C 10: 121,840,848 T414A probably benign Het
Syt14 A G 1: 193,035,628 I3T probably benign Het
Tnpo2 G A 8: 85,047,137 V303M possibly damaging Het
Tstd2 A C 4: 46,119,955 S332R probably damaging Het
Ttn C A 2: 76,752,042 A22836S possibly damaging Het
Ufl1 A G 4: 25,250,669 V728A probably benign Het
Usp33 A T 3: 152,384,191 K789N possibly damaging Het
Usp54 T A 14: 20,588,370 Q214L probably damaging Het
Vmn2r7 T G 3: 64,715,777 N374T probably benign Het
Zbtb7a T A 10: 81,144,600 N209K probably damaging Het
Zc3hav1 A G 6: 38,329,272 V615A probably benign Het
Zdhhc20 A G 14: 57,873,891 probably null Het
Zfp90 G T 8: 106,425,148 V498L probably damaging Het
Other mutations in Col4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col4a2 APN 8 11443685 missense probably damaging 1.00
IGL00485:Col4a2 APN 8 11439012 missense probably benign
IGL00909:Col4a2 APN 8 11448167 missense possibly damaging 0.91
IGL01574:Col4a2 APN 8 11439306 missense probably damaging 1.00
IGL01914:Col4a2 APN 8 11414754 missense possibly damaging 0.57
IGL02147:Col4a2 APN 8 11408140 missense probably benign 0.28
IGL02205:Col4a2 APN 8 11431305 nonsense probably null
IGL02423:Col4a2 APN 8 11433800 missense probably benign
IGL03131:Col4a2 APN 8 11425979 missense probably benign
band UTSW 8 11448225 missense probably benign 0.00
binder UTSW 8 11416070 missense probably damaging 1.00
G4846:Col4a2 UTSW 8 11408872 splice site probably benign
IGL03054:Col4a2 UTSW 8 11448270 missense probably damaging 0.96
R0087:Col4a2 UTSW 8 11441296 missense probably benign
R0124:Col4a2 UTSW 8 11408871 splice site probably benign
R0603:Col4a2 UTSW 8 11414779 missense probably benign
R0646:Col4a2 UTSW 8 11431252 missense probably benign 0.17
R0970:Col4a2 UTSW 8 11415438 missense probably benign 0.00
R1738:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R1746:Col4a2 UTSW 8 11446020 missense probably benign 0.35
R1826:Col4a2 UTSW 8 11313509 critical splice donor site probably null
R1834:Col4a2 UTSW 8 11402997 missense probably benign 0.10
R2016:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2017:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2124:Col4a2 UTSW 8 11416070 missense probably damaging 1.00
R2137:Col4a2 UTSW 8 11433749 missense probably benign
R2207:Col4a2 UTSW 8 11443352 missense probably damaging 1.00
R3156:Col4a2 UTSW 8 11313414 unclassified probably benign
R4169:Col4a2 UTSW 8 11429391 missense probably benign 0.22
R4679:Col4a2 UTSW 8 11431337 missense possibly damaging 0.68
R4705:Col4a2 UTSW 8 11313504 missense possibly damaging 0.52
R4710:Col4a2 UTSW 8 11409462 missense probably benign 0.22
R4716:Col4a2 UTSW 8 11402224 missense probably damaging 1.00
R4730:Col4a2 UTSW 8 11437590 missense probably benign
R4732:Col4a2 UTSW 8 11414779 missense probably benign
R4732:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4733:Col4a2 UTSW 8 11414779 missense probably benign
R4733:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4834:Col4a2 UTSW 8 11406836 nonsense probably null
R4835:Col4a2 UTSW 8 11423570 nonsense probably null
R4953:Col4a2 UTSW 8 11429505 missense probably benign 0.02
R5078:Col4a2 UTSW 8 11443936 missense probably benign
R5204:Col4a2 UTSW 8 11398651 splice site probably null
R5221:Col4a2 UTSW 8 11448225 missense probably benign 0.00
R5355:Col4a2 UTSW 8 11445984 missense probably damaging 0.96
R5478:Col4a2 UTSW 8 11398697 missense probably benign 0.21
R5492:Col4a2 UTSW 8 11438608 missense possibly damaging 0.82
R5646:Col4a2 UTSW 8 11441281 missense probably damaging 1.00
R5857:Col4a2 UTSW 8 11425442 missense probably damaging 1.00
R5948:Col4a2 UTSW 8 11420600 missense probably benign 0.21
R6329:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R6496:Col4a2 UTSW 8 11402993 nonsense probably null
R6496:Col4a2 UTSW 8 11402994 missense probably damaging 1.00
R6531:Col4a2 UTSW 8 11408135 missense probably benign 0.00
R7185:Col4a2 UTSW 8 11399739 missense probably damaging 0.99
R7266:Col4a2 UTSW 8 11425542 critical splice donor site probably null
R7308:Col4a2 UTSW 8 11406856 critical splice donor site probably null
R7341:Col4a2 UTSW 8 11398678 missense probably damaging 0.97
R7394:Col4a2 UTSW 8 11446184 missense probably benign 0.00
R7434:Col4a2 UTSW 8 11421250 missense probably damaging 1.00
R7606:Col4a2 UTSW 8 11443571 missense probably benign 0.00
R7646:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R7712:Col4a2 UTSW 8 11425376 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGTCATTCCGTAGCCAGC -3'
(R):5'- AGTGTCTACCCACAGCAGAG -3'

Sequencing Primer
(F):5'- AGCAGTCCCTCCGTGGTG -3'
(R):5'- AGCAGAGGACCCTAGCCATG -3'
Posted On2019-06-26