Incidental Mutation 'R0591:Dglucy'
ID55996
Institutional Source Beutler Lab
Gene Symbol Dglucy
Ensembl Gene ENSMUSG00000021185
Gene NameD-glutamate cyclase
Synonyms9030617O03Rik
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0591 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location100779057-100896981 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 100859518 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069782] [ENSMUST00000110069] [ENSMUST00000110070] [ENSMUST00000110073] [ENSMUST00000167322]
Predicted Effect probably benign
Transcript: ENSMUST00000069782
SMART Domains Protein: ENSMUSP00000067830
Gene: ENSMUSG00000021185

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 1.1e-51 PFAM
Pfam:DUF4392 298 612 4.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110069
SMART Domains Protein: ENSMUSP00000105696
Gene: ENSMUSG00000021185

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 1.1e-51 PFAM
Pfam:DUF4392 298 612 4.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110070
SMART Domains Protein: ENSMUSP00000105697
Gene: ENSMUSG00000021185

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 2.8e-51 PFAM
Pfam:DUF4392 298 563 2.5e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110073
SMART Domains Protein: ENSMUSP00000105700
Gene: ENSMUSG00000021185

DomainStartEndE-ValueType
Pfam:DUF1445 145 287 7.2e-54 PFAM
Pfam:DUF4392 329 640 2.3e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117972
Predicted Effect probably benign
Transcript: ENSMUST00000167322
SMART Domains Protein: ENSMUSP00000129876
Gene: ENSMUSG00000021185

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 1.1e-51 PFAM
Pfam:DUF4392 298 612 4.2e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222484
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated D-glutamate levels in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Usp4 G A 9: 108,348,029 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Dglucy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Dglucy APN 12 100853217 missense probably damaging 1.00
IGL01885:Dglucy APN 12 100850281 missense probably damaging 0.97
IGL01911:Dglucy APN 12 100838525 missense probably damaging 0.96
IGL02240:Dglucy APN 12 100871413 missense possibly damaging 0.51
IGL02388:Dglucy APN 12 100856998 missense probably damaging 1.00
IGL02653:Dglucy APN 12 100871431 missense probably benign
IGL02829:Dglucy APN 12 100871404 missense probably damaging 1.00
R0096:Dglucy UTSW 12 100838651 missense possibly damaging 0.94
R0096:Dglucy UTSW 12 100838651 missense possibly damaging 0.94
R1723:Dglucy UTSW 12 100842679 missense probably damaging 1.00
R1765:Dglucy UTSW 12 100850102 splice site probably null
R1926:Dglucy UTSW 12 100867155 missense possibly damaging 0.94
R1968:Dglucy UTSW 12 100859644 missense possibly damaging 0.95
R2004:Dglucy UTSW 12 100856922 missense probably damaging 1.00
R3117:Dglucy UTSW 12 100838678 missense probably benign
R3716:Dglucy UTSW 12 100850116 missense probably damaging 0.97
R3946:Dglucy UTSW 12 100838700 critical splice donor site probably null
R3976:Dglucy UTSW 12 100841389 missense probably benign 0.01
R4782:Dglucy UTSW 12 100850343 missense probably benign 0.00
R4784:Dglucy UTSW 12 100838664 missense probably damaging 0.99
R4799:Dglucy UTSW 12 100850343 missense probably benign 0.00
R5037:Dglucy UTSW 12 100835241 missense probably benign 0.09
R5468:Dglucy UTSW 12 100850335 missense probably benign 0.01
R5609:Dglucy UTSW 12 100787646 missense probably null
R5994:Dglucy UTSW 12 100842700 missense probably benign 0.00
R6452:Dglucy UTSW 12 100835209 missense possibly damaging 0.93
R7257:Dglucy UTSW 12 100842738 missense probably damaging 1.00
R7488:Dglucy UTSW 12 100857051 missense possibly damaging 0.95
R7580:Dglucy UTSW 12 100850164 missense probably benign 0.29
R7589:Dglucy UTSW 12 100841401 missense probably damaging 1.00
X0025:Dglucy UTSW 12 100838664 missense possibly damaging 0.84
X0061:Dglucy UTSW 12 100838598 missense probably benign 0.04
Z1176:Dglucy UTSW 12 100853304 missense not run
Predicted Primers PCR Primer
(F):5'- AGACACAGTCCCACTCTAGCGAG -3'
(R):5'- CATAGAGATAGAGCTGGGTTGCTCCTT -3'

Sequencing Primer
(F):5'- AGCTCCAAAGTTAGGTTCACTTC -3'
(R):5'- cccagaaataagtccctccc -3'
Posted On2013-07-11