Incidental Mutation 'R7197:Adgrb2'
ID560000
Institutional Source Beutler Lab
Gene Symbol Adgrb2
Ensembl Gene ENSMUSG00000028782
Gene Nameadhesion G protein-coupled receptor B2
SynonymsBai2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7197 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129984870-130022633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130009522 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 613 (N613S)
Ref Sequence ENSEMBL: ENSMUSP00000112524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030571] [ENSMUST00000097868] [ENSMUST00000106015] [ENSMUST00000106017] [ENSMUST00000106018] [ENSMUST00000120204] [ENSMUST00000121049]
Predicted Effect probably damaging
Transcript: ENSMUST00000030571
AA Change: N668S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030571
Gene: ENSMUSG00000028782
AA Change: N668S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:GAIN 600 842 1.6e-41 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 1.7e-67 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097868
AA Change: N668S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095480
Gene: ENSMUSG00000028782
AA Change: N668S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 1.2e-54 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1159 2.6e-69 PFAM
low complexity region 1324 1338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106015
AA Change: N668S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101636
Gene: ENSMUSG00000028782
AA Change: N668S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.4e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 4.1e-68 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106017
AA Change: N668S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101638
Gene: ENSMUSG00000028782
AA Change: N668S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.3e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1180 4.6e-68 PFAM
low complexity region 1345 1359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106018
AA Change: N613S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101639
Gene: ENSMUSG00000028782
AA Change: N613S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 1.1e-54 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 2.4e-69 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120204
AA Change: N613S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112524
Gene: ENSMUSG00000028782
AA Change: N613S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 8.2e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 9.6e-70 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121049
AA Change: N613S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112869
Gene: ENSMUSG00000028782
AA Change: N613S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 6.1e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1137 3.8e-68 PFAM
low complexity region 1302 1316 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a a seven-span transmembrane protein that is thought to be a member of the secretin receptor family. The encoded protein is a brain-specific inhibitor of angiogenesis. The mature peptide may be further cleaved into additional products (PMID:20367554). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene show a lessening of depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
Aars2 T C 17: 45,508,959 Y221H probably damaging Het
Abca8b G A 11: 109,945,822 R1216* probably null Het
Acad8 A T 9: 26,977,671 probably null Het
Acer2 A G 4: 86,887,050 T84A probably null Het
Arap2 T C 5: 62,641,386 D1300G possibly damaging Het
Ccl11 A T 11: 82,057,839 probably benign Het
Cfh A T 1: 140,088,767 Y1151* probably null Het
Cobll1 A G 2: 65,098,538 S815P probably benign Het
Cryz T C 3: 154,621,568 S240P probably damaging Het
Csmd2 A G 4: 128,511,033 Y2404C Het
F13a1 T C 13: 36,916,886 D428G probably damaging Het
Fbxo42 A G 4: 141,200,085 S559G probably benign Het
Fry A G 5: 150,469,767 S263G Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Gatsl3 T C 11: 4,218,949 C39R probably damaging Het
Gm1527 A G 3: 28,926,541 M597V probably null Het
Gpr158 A T 2: 21,810,601 T602S probably damaging Het
Hmgxb4 C A 8: 75,029,996 T583K probably damaging Het
Igkv8-30 C T 6: 70,117,085 C114Y probably damaging Het
Igsf5 T A 16: 96,403,346 N366K probably damaging Het
Kif15 T C 9: 123,009,926 probably null Het
Klk1b26 T A 7: 44,016,397 probably null Het
Lama1 G T 17: 67,737,705 E200* probably null Het
Lpar5 C T 6: 125,082,384 T356I probably benign Het
Lrch3 A T 16: 32,990,295 T538S probably damaging Het
Mansc4 A G 6: 147,075,705 S138P probably damaging Het
Mief1 T C 15: 80,249,860 S373P possibly damaging Het
Nbas G T 12: 13,520,750 V2053F possibly damaging Het
Nek11 T C 9: 105,244,415 E435G probably damaging Het
Nynrin A T 14: 55,871,923 I1496F probably benign Het
Odf1 A T 15: 38,219,550 M41L probably benign Het
Olfr1209 A T 2: 88,910,364 F10I probably benign Het
Olfr1220 A G 2: 89,097,282 V215A probably benign Het
Olfr713 A G 7: 107,036,157 M8V probably benign Het
Olfr871 T G 9: 20,212,555 S69A probably benign Het
Oxnad1 T C 14: 32,096,516 V106A possibly damaging Het
Padi4 C A 4: 140,761,658 E157* probably null Het
Parp10 A T 15: 76,242,416 F217L probably damaging Het
Pcdhb18 T A 18: 37,490,383 S255R probably benign Het
Pde4c G T 8: 70,745,329 G102W probably damaging Het
Pde6a T C 18: 61,258,224 Y547H probably damaging Het
Phf11b A T 14: 59,326,058 L137I probably benign Het
Pigh A C 12: 79,083,689 I134S probably damaging Het
Pigt G A 2: 164,502,516 V362M probably damaging Het
Pld1 A G 3: 28,024,252 D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 R282G probably damaging Het
Ppp2r5d A G 17: 46,685,601 V382A probably damaging Het
Prdm16 T C 4: 154,341,510 E606G probably damaging Het
Psg28 A G 7: 18,430,584 Y68H probably damaging Het
Qpctl C A 7: 19,149,019 W56L probably damaging Het
Rab11fip5 G A 6: 85,342,155 P584L probably damaging Het
Sde2 C T 1: 180,851,278 H36Y probably benign Het
Sema4d T C 13: 51,702,836 S787G probably benign Het
Sgca C T 11: 94,973,188 probably null Het
Shroom3 A G 5: 92,942,604 E1071G probably damaging Het
Skint5 A G 4: 113,580,482 probably null Het
Slc44a3 T A 3: 121,525,762 D110V probably benign Het
Slc4a4 A C 5: 88,934,574 probably benign Het
Slc4a8 A G 15: 100,790,976 D389G probably damaging Het
Sp3 C G 2: 72,979,609 E11Q probably benign Het
Srrm2 A G 17: 23,818,224 S1281G unknown Het
Tat A T 8: 109,996,827 I316F probably benign Het
Thoc5 A G 11: 4,915,563 T381A probably benign Het
Tiam1 T C 16: 89,884,938 Y384C probably damaging Het
Tmem45a A T 16: 56,811,663 F197L probably damaging Het
Trav8d-1 A G 14: 52,778,978 Y107C probably damaging Het
Trim10 T A 17: 36,876,954 V354D probably damaging Het
Unc45b A T 11: 82,940,187 probably null Het
Unc79 A G 12: 103,112,506 I1643M probably benign Het
Unc80 G T 1: 66,521,566 G818* probably null Het
Usp15 A T 10: 123,131,005 M470K possibly damaging Het
Vldlr T C 19: 27,234,841 V85A probably benign Het
Vma21-ps A G 4: 52,496,994 V84A probably benign Het
Vmn2r67 C T 7: 85,136,566 V744I possibly damaging Het
Wdr73 A G 7: 80,893,198 C221R probably benign Het
Zxdc C T 6: 90,378,837 H443Y probably damaging Het
Other mutations in Adgrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Adgrb2 APN 4 130018805 missense probably damaging 1.00
IGL00425:Adgrb2 APN 4 130019072 missense probably benign 0.09
IGL00490:Adgrb2 APN 4 130011872 missense possibly damaging 0.82
IGL00928:Adgrb2 APN 4 129992303 missense probably benign
IGL01353:Adgrb2 APN 4 130012300 missense probably damaging 1.00
IGL01521:Adgrb2 APN 4 129992292 missense probably damaging 0.98
IGL01590:Adgrb2 APN 4 130013813 splice site probably benign
IGL01813:Adgrb2 APN 4 130012566 missense probably benign 0.00
IGL01831:Adgrb2 APN 4 130009394 missense probably damaging 1.00
IGL01939:Adgrb2 APN 4 129992132 missense probably damaging 0.99
IGL01960:Adgrb2 APN 4 130012384 splice site probably benign
IGL01993:Adgrb2 APN 4 130018842 missense possibly damaging 0.94
IGL02646:Adgrb2 APN 4 130019282 critical splice donor site probably null
IGL02655:Adgrb2 APN 4 129992179 nonsense probably null
IGL02695:Adgrb2 APN 4 130018832 missense probably damaging 1.00
IGL02998:Adgrb2 APN 4 130019069 missense probably benign 0.15
IGL03372:Adgrb2 APN 4 130017569 missense probably benign 0.42
R0098:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0206:Adgrb2 UTSW 4 129992559 missense probably damaging 1.00
R0311:Adgrb2 UTSW 4 130017129 missense probably damaging 1.00
R0380:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0382:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0492:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0544:Adgrb2 UTSW 4 130017542 missense probably damaging 0.98
R0965:Adgrb2 UTSW 4 129992416 small deletion probably benign
R1458:Adgrb2 UTSW 4 130014591 missense possibly damaging 0.48
R1601:Adgrb2 UTSW 4 129992837 missense probably benign 0.43
R1711:Adgrb2 UTSW 4 129992624 missense probably damaging 1.00
R1758:Adgrb2 UTSW 4 130011875 missense probably damaging 1.00
R1783:Adgrb2 UTSW 4 130009305 missense possibly damaging 0.61
R1827:Adgrb2 UTSW 4 130012557 missense probably damaging 1.00
R1838:Adgrb2 UTSW 4 130010231 missense probably benign 0.00
R1881:Adgrb2 UTSW 4 130010285 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1894:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R2275:Adgrb2 UTSW 4 130006854 missense probably damaging 1.00
R2926:Adgrb2 UTSW 4 130008344 missense probably damaging 1.00
R4472:Adgrb2 UTSW 4 130008353 missense probably benign 0.12
R4490:Adgrb2 UTSW 4 130012328 missense possibly damaging 0.91
R4499:Adgrb2 UTSW 4 129992661 missense probably damaging 0.99
R4758:Adgrb2 UTSW 4 130009350 missense probably damaging 1.00
R4900:Adgrb2 UTSW 4 130013875 missense probably damaging 1.00
R4904:Adgrb2 UTSW 4 130012539 missense possibly damaging 0.50
R4922:Adgrb2 UTSW 4 130007852 missense probably damaging 1.00
R5330:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5331:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5550:Adgrb2 UTSW 4 130014934 critical splice acceptor site probably null
R5995:Adgrb2 UTSW 4 130017103 missense probably damaging 1.00
R6047:Adgrb2 UTSW 4 130018705 missense probably damaging 1.00
R6534:Adgrb2 UTSW 4 130022219 missense probably damaging 0.98
R6565:Adgrb2 UTSW 4 130019276 missense probably damaging 1.00
R6813:Adgrb2 UTSW 4 130009491 missense probably damaging 1.00
R6963:Adgrb2 UTSW 4 130014362 frame shift probably null
R6966:Adgrb2 UTSW 4 130014362 frame shift probably null
R7409:Adgrb2 UTSW 4 130019069 missense probably benign 0.15
R7451:Adgrb2 UTSW 4 130014557 missense probably damaging 1.00
R7453:Adgrb2 UTSW 4 130014637 critical splice donor site probably null
R7461:Adgrb2 UTSW 4 130021213 critical splice acceptor site probably benign
R7511:Adgrb2 UTSW 4 130022111 missense probably benign
R7613:Adgrb2 UTSW 4 130021213 critical splice acceptor site probably benign
R7729:Adgrb2 UTSW 4 129992124 missense probably benign 0.09
R7818:Adgrb2 UTSW 4 130014560 missense probably damaging 0.98
R7818:Adgrb2 UTSW 4 130014969 missense possibly damaging 0.70
R8033:Adgrb2 UTSW 4 130019012 missense probably benign
R8039:Adgrb2 UTSW 4 130022268 missense probably damaging 0.99
RF020:Adgrb2 UTSW 4 130010084 missense probably damaging 1.00
Z1176:Adgrb2 UTSW 4 130017563 missense probably damaging 1.00
Z1177:Adgrb2 UTSW 4 130011826 missense probably damaging 0.99
Z1177:Adgrb2 UTSW 4 130019119 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGTCACTGACACCTTCAAG -3'
(R):5'- CGTGACAATGAGAGAGCTCTG -3'

Sequencing Primer
(F):5'- ATGGAGGTTCACACCTC -3'
(R):5'- GCCCACGAGGTGAATGAAATCTTC -3'
Posted On2019-06-26