Incidental Mutation 'R7197:Wdr73'
ID 560016
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 1200011I23Rik, 2410008B13Rik
MMRRC Submission 045276-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.259) question?
Stock # R7197 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80540471-80551017 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80542946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 221 (C221R)
Ref Sequence ENSEMBL: ENSMUSP00000026816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816]
AlphaFold Q9CWR1
Predicted Effect probably benign
Transcript: ENSMUST00000026816
AA Change: C221R

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: C221R

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722
AA Change: C194R

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,165,505 (GRCm39) probably null Het
Aars2 T C 17: 45,819,885 (GRCm39) Y221H probably damaging Het
Abca8b G A 11: 109,836,648 (GRCm39) R1216* probably null Het
Acad8 A T 9: 26,888,967 (GRCm39) probably null Het
Acer2 A G 4: 86,805,287 (GRCm39) T84A probably null Het
Adgrb2 A G 4: 129,903,315 (GRCm39) N613S probably damaging Het
Arap2 T C 5: 62,798,729 (GRCm39) D1300G possibly damaging Het
Castor1 T C 11: 4,168,949 (GRCm39) C39R probably damaging Het
Ccl11 A T 11: 81,948,665 (GRCm39) probably benign Het
Cfh A T 1: 140,016,505 (GRCm39) Y1151* probably null Het
Cobll1 A G 2: 64,928,882 (GRCm39) S815P probably benign Het
Cryz T C 3: 154,327,205 (GRCm39) S240P probably damaging Het
Csmd2 A G 4: 128,404,826 (GRCm39) Y2404C Het
F13a1 T C 13: 37,100,860 (GRCm39) D428G probably damaging Het
Fbxo42 A G 4: 140,927,396 (GRCm39) S559G probably benign Het
Fry A G 5: 150,393,232 (GRCm39) S263G Het
Fshr C T 17: 89,292,897 (GRCm39) A594T probably damaging Het
Gm1527 A G 3: 28,980,690 (GRCm39) M597V probably null Het
Gpr158 A T 2: 21,815,412 (GRCm39) T602S probably damaging Het
Hmgxb4 C A 8: 75,756,624 (GRCm39) T583K probably damaging Het
Igkv8-30 C T 6: 70,094,069 (GRCm39) C114Y probably damaging Het
Igsf5 T A 16: 96,204,546 (GRCm39) N366K probably damaging Het
Kif15 T C 9: 122,838,991 (GRCm39) probably null Het
Klk1b26 T A 7: 43,665,821 (GRCm39) probably null Het
Lama1 G T 17: 68,044,700 (GRCm39) E200* probably null Het
Lpar5 C T 6: 125,059,347 (GRCm39) T356I probably benign Het
Lrch3 A T 16: 32,810,665 (GRCm39) T538S probably damaging Het
Mansc4 A G 6: 146,977,203 (GRCm39) S138P probably damaging Het
Mief1 T C 15: 80,134,061 (GRCm39) S373P possibly damaging Het
Nbas G T 12: 13,570,751 (GRCm39) V2053F possibly damaging Het
Nek11 T C 9: 105,121,614 (GRCm39) E435G probably damaging Het
Nynrin A T 14: 56,109,380 (GRCm39) I1496F probably benign Het
Odf1 A T 15: 38,219,794 (GRCm39) M41L probably benign Het
Or10a5 A G 7: 106,635,364 (GRCm39) M8V probably benign Het
Or4c115 A G 2: 88,927,626 (GRCm39) V215A probably benign Het
Or4c29 A T 2: 88,740,708 (GRCm39) F10I probably benign Het
Or7h8 T G 9: 20,123,851 (GRCm39) S69A probably benign Het
Oxnad1 T C 14: 31,818,473 (GRCm39) V106A possibly damaging Het
Padi4 C A 4: 140,488,969 (GRCm39) E157* probably null Het
Parp10 A T 15: 76,126,616 (GRCm39) F217L probably damaging Het
Pcdhb18 T A 18: 37,623,436 (GRCm39) S255R probably benign Het
Pde4c G T 8: 71,197,978 (GRCm39) G102W probably damaging Het
Pde6a T C 18: 61,391,295 (GRCm39) Y547H probably damaging Het
Phf11b A T 14: 59,563,507 (GRCm39) L137I probably benign Het
Pigh A C 12: 79,130,463 (GRCm39) I134S probably damaging Het
Pigt G A 2: 164,344,436 (GRCm39) V362M probably damaging Het
Pld1 A G 3: 28,078,401 (GRCm39) D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 (GRCm39) R282G probably damaging Het
Ppp2r5d A G 17: 46,996,527 (GRCm39) V382A probably damaging Het
Prdm16 T C 4: 154,425,967 (GRCm39) E606G probably damaging Het
Psg28 A G 7: 18,164,509 (GRCm39) Y68H probably damaging Het
Qpctl C A 7: 18,882,944 (GRCm39) W56L probably damaging Het
Rab11fip5 G A 6: 85,319,137 (GRCm39) P584L probably damaging Het
Sde2 C T 1: 180,678,843 (GRCm39) H36Y probably benign Het
Sema4d T C 13: 51,856,872 (GRCm39) S787G probably benign Het
Sgca C T 11: 94,864,014 (GRCm39) probably null Het
Shroom3 A G 5: 93,090,463 (GRCm39) E1071G probably damaging Het
Skint5 A G 4: 113,437,679 (GRCm39) probably null Het
Slc44a3 T A 3: 121,319,411 (GRCm39) D110V probably benign Het
Slc4a4 A C 5: 89,082,433 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,688,857 (GRCm39) D389G probably damaging Het
Sp3 C G 2: 72,809,953 (GRCm39) E11Q probably benign Het
Srrm2 A G 17: 24,037,198 (GRCm39) S1281G unknown Het
Tat A T 8: 110,723,459 (GRCm39) I316F probably benign Het
Thoc5 A G 11: 4,865,563 (GRCm39) T381A probably benign Het
Tiam1 T C 16: 89,681,826 (GRCm39) Y384C probably damaging Het
Tmem45a A T 16: 56,632,026 (GRCm39) F197L probably damaging Het
Trav8d-1 A G 14: 53,016,435 (GRCm39) Y107C probably damaging Het
Trim10 T A 17: 37,187,846 (GRCm39) V354D probably damaging Het
Unc45b A T 11: 82,831,013 (GRCm39) probably null Het
Unc79 A G 12: 103,078,765 (GRCm39) I1643M probably benign Het
Unc80 G T 1: 66,560,725 (GRCm39) G818* probably null Het
Usp15 A T 10: 122,966,910 (GRCm39) M470K possibly damaging Het
Vldlr T C 19: 27,212,241 (GRCm39) V85A probably benign Het
Vma21-ps A G 4: 52,496,994 (GRCm39) V84A probably benign Het
Vmn2r67 C T 7: 84,785,774 (GRCm39) V744I possibly damaging Het
Zxdc C T 6: 90,355,819 (GRCm39) H443Y probably damaging Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80,543,411 (GRCm39) missense probably benign 0.01
IGL02183:Wdr73 APN 7 80,543,508 (GRCm39) missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80,547,694 (GRCm39) missense probably benign 0.00
3-1:Wdr73 UTSW 7 80,547,707 (GRCm39) missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80,547,698 (GRCm39) nonsense probably null
R0507:Wdr73 UTSW 7 80,541,594 (GRCm39) missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80,547,698 (GRCm39) nonsense probably null
R1349:Wdr73 UTSW 7 80,543,000 (GRCm39) missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80,541,526 (GRCm39) missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80,543,081 (GRCm39) missense probably benign 0.17
R3085:Wdr73 UTSW 7 80,550,990 (GRCm39) unclassified probably benign
R4478:Wdr73 UTSW 7 80,542,969 (GRCm39) missense probably benign 0.06
R4479:Wdr73 UTSW 7 80,542,969 (GRCm39) missense probably benign 0.06
R4480:Wdr73 UTSW 7 80,542,969 (GRCm39) missense probably benign 0.06
R4910:Wdr73 UTSW 7 80,541,456 (GRCm39) missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80,542,943 (GRCm39) missense probably benign 0.00
R5046:Wdr73 UTSW 7 80,542,173 (GRCm39) unclassified probably benign
R5286:Wdr73 UTSW 7 80,541,557 (GRCm39) missense probably benign 0.04
R5842:Wdr73 UTSW 7 80,541,458 (GRCm39) missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80,541,604 (GRCm39) missense probably benign 0.17
R7182:Wdr73 UTSW 7 80,543,426 (GRCm39) missense possibly damaging 0.45
R7362:Wdr73 UTSW 7 80,550,451 (GRCm39) missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80,542,975 (GRCm39) missense probably benign 0.13
R8558:Wdr73 UTSW 7 80,548,254 (GRCm39) missense probably damaging 1.00
R8950:Wdr73 UTSW 7 80,550,131 (GRCm39) missense probably benign 0.00
X0022:Wdr73 UTSW 7 80,547,699 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TAGCCAAGCAGTTGTCCAGG -3'
(R):5'- AGGGTTTCTGTGCCAGATGC -3'

Sequencing Primer
(F):5'- TCACCCGCAGCAGCTCTG -3'
(R):5'- CACCAGCAGAGCAGACTGG -3'
Posted On 2019-06-26