Mutagenetix > Incidental Mutations

Incidental Mutation 'R7197:Wdr73'

560016

Institutional Source

Beutler Lab

Gene Symbol

Wdr73

Ensembl Gene

ENSMUSG00000025722

Gene Name

WD repeat domain 73

Synonyms

2410008B13Rik, 1200011I23Rik

MMRRC Submission

Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene?

Possibly non essential (E-score: 0.393) question?

Stock #

R7197 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80890723-80901269 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80893198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 221 (C221R)

Ref Sequence

ENSEMBL: ENSMUSP00000026816 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026816]

AlphaFold

Q9CWR1

Predicted Effect

probably benign
Transcript: ENSMUST00000026816
AA Change: C221R

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: C221R

Domain	Start	End	E-Value	Type
WD40	67	112	8.52e1	SMART
Blast:WD40	162	204	3e-6	BLAST
Blast:WD40	208	254	3e-17	BLAST
WD40	263	304	2.57e0	SMART
WD40	314	364	8.91e-1	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722
AA Change: C194R

Domain	Start	End	E-Value	Type
Blast:WD40	66	111	3e-26	BLAST
Blast:WD40	182	228	4e-18	BLAST

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]

Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	AGCTTCCCTGCTT	AGCTT	9: 57,258,222		probably null	Het
Aars2	T	C	17: 45,508,959	Y221H	probably damaging	Het
Abca8b	G	A	11: 109,945,822	R1216*	probably null	Het
Acad8	A	T	9: 26,977,671		probably null	Het
Acer2	A	G	4: 86,887,050	T84A	probably null	Het
Adgrb2	A	G	4: 130,009,522	N613S	probably damaging	Het
Arap2	T	C	5: 62,641,386	D1300G	possibly damaging	Het
Ccl11	A	T	11: 82,057,839		probably benign	Het
Cfh	A	T	1: 140,088,767	Y1151*	probably null	Het
Cobll1	A	G	2: 65,098,538	S815P	probably benign	Het
Cryz	T	C	3: 154,621,568	S240P	probably damaging	Het
Csmd2	A	G	4: 128,511,033	Y2404C		Het
F13a1	T	C	13: 36,916,886	D428G	probably damaging	Het
Fbxo42	A	G	4: 141,200,085	S559G	probably benign	Het
Fry	A	G	5: 150,469,767	S263G		Het
Fshr	C	T	17: 88,985,469	A594T	probably damaging	Het
Gatsl3	T	C	11: 4,218,949	C39R	probably damaging	Het
Gm1527	A	G	3: 28,926,541	M597V	probably null	Het
Gpr158	A	T	2: 21,810,601	T602S	probably damaging	Het
Hmgxb4	C	A	8: 75,029,996	T583K	probably damaging	Het
Igkv8-30	C	T	6: 70,117,085	C114Y	probably damaging	Het
Igsf5	T	A	16: 96,403,346	N366K	probably damaging	Het
Kif15	T	C	9: 123,009,926		probably null	Het
Klk1b26	T	A	7: 44,016,397		probably null	Het
Lama1	G	T	17: 67,737,705	E200*	probably null	Het
Lpar5	C	T	6: 125,082,384	T356I	probably benign	Het
Lrch3	A	T	16: 32,990,295	T538S	probably damaging	Het
Mansc4	A	G	6: 147,075,705	S138P	probably damaging	Het
Mief1	T	C	15: 80,249,860	S373P	possibly damaging	Het
Nbas	G	T	12: 13,520,750	V2053F	possibly damaging	Het
Nek11	T	C	9: 105,244,415	E435G	probably damaging	Het
Nynrin	A	T	14: 55,871,923	I1496F	probably benign	Het
Odf1	A	T	15: 38,219,550	M41L	probably benign	Het
Olfr1209	A	T	2: 88,910,364	F10I	probably benign	Het
Olfr1220	A	G	2: 89,097,282	V215A	probably benign	Het
Olfr713	A	G	7: 107,036,157	M8V	probably benign	Het
Olfr871	T	G	9: 20,212,555	S69A	probably benign	Het
Oxnad1	T	C	14: 32,096,516	V106A	possibly damaging	Het
Padi4	C	A	4: 140,761,658	E157*	probably null	Het
Parp10	A	T	15: 76,242,416	F217L	probably damaging	Het
Pcdhb18	T	A	18: 37,490,383	S255R	probably benign	Het
Pde4c	G	T	8: 70,745,329	G102W	probably damaging	Het
Pde6a	T	C	18: 61,258,224	Y547H	probably damaging	Het
Phf11b	A	T	14: 59,326,058	L137I	probably benign	Het
Pigh	A	C	12: 79,083,689	I134S	probably damaging	Het
Pigt	G	A	2: 164,502,516	V362M	probably damaging	Het
Pld1	A	G	3: 28,024,252	D20G	probably damaging	Het
Pou3f2	T	C	4: 22,487,288	R282G	probably damaging	Het
Ppp2r5d	A	G	17: 46,685,601	V382A	probably damaging	Het
Prdm16	T	C	4: 154,341,510	E606G	probably damaging	Het
Psg28	A	G	7: 18,430,584	Y68H	probably damaging	Het
Qpctl	C	A	7: 19,149,019	W56L	probably damaging	Het
Rab11fip5	G	A	6: 85,342,155	P584L	probably damaging	Het
Sde2	C	T	1: 180,851,278	H36Y	probably benign	Het
Sema4d	T	C	13: 51,702,836	S787G	probably benign	Het
Sgca	C	T	11: 94,973,188		probably null	Het
Shroom3	A	G	5: 92,942,604	E1071G	probably damaging	Het
Skint5	A	G	4: 113,580,482		probably null	Het
Slc44a3	T	A	3: 121,525,762	D110V	probably benign	Het
Slc4a4	A	C	5: 88,934,574		probably benign	Het
Slc4a8	A	G	15: 100,790,976	D389G	probably damaging	Het
Sp3	C	G	2: 72,979,609	E11Q	probably benign	Het
Srrm2	A	G	17: 23,818,224	S1281G	unknown	Het
Tat	A	T	8: 109,996,827	I316F	probably benign	Het
Thoc5	A	G	11: 4,915,563	T381A	probably benign	Het
Tiam1	T	C	16: 89,884,938	Y384C	probably damaging	Het
Tmem45a	A	T	16: 56,811,663	F197L	probably damaging	Het
Trav8d-1	A	G	14: 52,778,978	Y107C	probably damaging	Het
Trim10	T	A	17: 36,876,954	V354D	probably damaging	Het
Unc45b	A	T	11: 82,940,187		probably null	Het
Unc79	A	G	12: 103,112,506	I1643M	probably benign	Het
Unc80	G	T	1: 66,521,566	G818*	probably null	Het
Usp15	A	T	10: 123,131,005	M470K	possibly damaging	Het
Vldlr	T	C	19: 27,234,841	V85A	probably benign	Het
Vma21-ps	A	G	4: 52,496,994	V84A	probably benign	Het
Vmn2r67	C	T	7: 85,136,566	V744I	possibly damaging	Het
Zxdc	C	T	6: 90,378,837	H443Y	probably damaging	Het

Other mutations in Wdr73

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Wdr73	APN	7	80893663	missense	probably benign	0.01
IGL02183:Wdr73	APN	7	80893760	missense	probably damaging	1.00
IGL03253:Wdr73	APN	7	80897946	missense	probably benign	0.00
3-1:Wdr73	UTSW	7	80897959	missense	possibly damaging	0.91
R0469:Wdr73	UTSW	7	80897950	nonsense	probably null
R0507:Wdr73	UTSW	7	80891846	missense	possibly damaging	0.88
R0510:Wdr73	UTSW	7	80897950	nonsense	probably null
R1349:Wdr73	UTSW	7	80893252	missense	probably damaging	1.00
R1782:Wdr73	UTSW	7	80891778	missense	probably damaging	1.00
R1917:Wdr73	UTSW	7	80893333	missense	probably benign	0.17
R3085:Wdr73	UTSW	7	80901242	unclassified	probably benign
R4478:Wdr73	UTSW	7	80893221	missense	probably benign	0.06
R4479:Wdr73	UTSW	7	80893221	missense	probably benign	0.06
R4480:Wdr73	UTSW	7	80893221	missense	probably benign	0.06
R4910:Wdr73	UTSW	7	80891708	missense	probably damaging	0.97
R4925:Wdr73	UTSW	7	80893195	missense	probably benign	0.00
R5046:Wdr73	UTSW	7	80892425	unclassified	probably benign
R5286:Wdr73	UTSW	7	80891809	missense	probably benign	0.04
R5842:Wdr73	UTSW	7	80891710	missense	probably damaging	1.00
R6991:Wdr73	UTSW	7	80891856	missense	probably benign	0.17
R7182:Wdr73	UTSW	7	80893678	missense	possibly damaging	0.45
R7362:Wdr73	UTSW	7	80900703	missense	probably damaging	1.00
R7771:Wdr73	UTSW	7	80893227	missense	probably benign	0.13
R8558:Wdr73	UTSW	7	80898506	missense	probably damaging	1.00
R8950:Wdr73	UTSW	7	80900383	missense	probably benign	0.00
X0022:Wdr73	UTSW	7	80897951	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TAGCCAAGCAGTTGTCCAGG -3'
(R):5'- AGGGTTTCTGTGCCAGATGC -3'

Sequencing Primer
(F):5'- TCACCCGCAGCAGCTCTG -3'
(R):5'- CACCAGCAGAGCAGACTGG -3'

Posted On

2019-06-26