Incidental Mutation 'R7197:Olfr713'
ID560018
Institutional Source Beutler Lab
Gene Symbol Olfr713
Ensembl Gene ENSMUSG00000073898
Gene Nameolfactory receptor 713
SynonymsGA_x6K02T2PBJ9-9415724-9416677, MOR263-1, P3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7197 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107031174-107040994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107036157 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 8 (M8V)
Ref Sequence ENSEMBL: ENSMUSP00000095743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098139] [ENSMUST00000213623]
Predicted Effect probably benign
Transcript: ENSMUST00000098139
AA Change: M8V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095743
Gene: ENSMUSG00000073898
AA Change: M8V

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.4e-57 PFAM
Pfam:7tm_1 49 298 2e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213623
AA Change: M1V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
Aars2 T C 17: 45,508,959 Y221H probably damaging Het
Abca8b G A 11: 109,945,822 R1216* probably null Het
Acad8 A T 9: 26,977,671 probably null Het
Acer2 A G 4: 86,887,050 T84A probably null Het
Adgrb2 A G 4: 130,009,522 N613S probably damaging Het
Arap2 T C 5: 62,641,386 D1300G possibly damaging Het
Ccl11 A T 11: 82,057,839 probably benign Het
Cfh A T 1: 140,088,767 Y1151* probably null Het
Cobll1 A G 2: 65,098,538 S815P probably benign Het
Cryz T C 3: 154,621,568 S240P probably damaging Het
Csmd2 A G 4: 128,511,033 Y2404C Het
F13a1 T C 13: 36,916,886 D428G probably damaging Het
Fbxo42 A G 4: 141,200,085 S559G probably benign Het
Fry A G 5: 150,469,767 S263G Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Gatsl3 T C 11: 4,218,949 C39R probably damaging Het
Gm1527 A G 3: 28,926,541 M597V probably null Het
Gpr158 A T 2: 21,810,601 T602S probably damaging Het
Hmgxb4 C A 8: 75,029,996 T583K probably damaging Het
Igkv8-30 C T 6: 70,117,085 C114Y probably damaging Het
Igsf5 T A 16: 96,403,346 N366K probably damaging Het
Kif15 T C 9: 123,009,926 probably null Het
Klk1b26 T A 7: 44,016,397 probably null Het
Lama1 G T 17: 67,737,705 E200* probably null Het
Lpar5 C T 6: 125,082,384 T356I probably benign Het
Lrch3 A T 16: 32,990,295 T538S probably damaging Het
Mansc4 A G 6: 147,075,705 S138P probably damaging Het
Mief1 T C 15: 80,249,860 S373P possibly damaging Het
Nbas G T 12: 13,520,750 V2053F possibly damaging Het
Nek11 T C 9: 105,244,415 E435G probably damaging Het
Nynrin A T 14: 55,871,923 I1496F probably benign Het
Odf1 A T 15: 38,219,550 M41L probably benign Het
Olfr1209 A T 2: 88,910,364 F10I probably benign Het
Olfr1220 A G 2: 89,097,282 V215A probably benign Het
Olfr871 T G 9: 20,212,555 S69A probably benign Het
Oxnad1 T C 14: 32,096,516 V106A possibly damaging Het
Padi4 C A 4: 140,761,658 E157* probably null Het
Parp10 A T 15: 76,242,416 F217L probably damaging Het
Pcdhb18 T A 18: 37,490,383 S255R probably benign Het
Pde4c G T 8: 70,745,329 G102W probably damaging Het
Pde6a T C 18: 61,258,224 Y547H probably damaging Het
Phf11b A T 14: 59,326,058 L137I probably benign Het
Pigh A C 12: 79,083,689 I134S probably damaging Het
Pigt G A 2: 164,502,516 V362M probably damaging Het
Pld1 A G 3: 28,024,252 D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 R282G probably damaging Het
Ppp2r5d A G 17: 46,685,601 V382A probably damaging Het
Prdm16 T C 4: 154,341,510 E606G probably damaging Het
Psg28 A G 7: 18,430,584 Y68H probably damaging Het
Qpctl C A 7: 19,149,019 W56L probably damaging Het
Rab11fip5 G A 6: 85,342,155 P584L probably damaging Het
Sde2 C T 1: 180,851,278 H36Y probably benign Het
Sema4d T C 13: 51,702,836 S787G probably benign Het
Sgca C T 11: 94,973,188 probably null Het
Shroom3 A G 5: 92,942,604 E1071G probably damaging Het
Skint5 A G 4: 113,580,482 probably null Het
Slc44a3 T A 3: 121,525,762 D110V probably benign Het
Slc4a4 A C 5: 88,934,574 probably benign Het
Slc4a8 A G 15: 100,790,976 D389G probably damaging Het
Sp3 C G 2: 72,979,609 E11Q probably benign Het
Srrm2 A G 17: 23,818,224 S1281G unknown Het
Tat A T 8: 109,996,827 I316F probably benign Het
Thoc5 A G 11: 4,915,563 T381A probably benign Het
Tiam1 T C 16: 89,884,938 Y384C probably damaging Het
Tmem45a A T 16: 56,811,663 F197L probably damaging Het
Trav8d-1 A G 14: 52,778,978 Y107C probably damaging Het
Trim10 T A 17: 36,876,954 V354D probably damaging Het
Unc45b A T 11: 82,940,187 probably null Het
Unc79 A G 12: 103,112,506 I1643M probably benign Het
Unc80 G T 1: 66,521,566 G818* probably null Het
Usp15 A T 10: 123,131,005 M470K possibly damaging Het
Vldlr T C 19: 27,234,841 V85A probably benign Het
Vma21-ps A G 4: 52,496,994 V84A probably benign Het
Vmn2r67 C T 7: 85,136,566 V744I possibly damaging Het
Wdr73 A G 7: 80,893,198 C221R probably benign Het
Zxdc C T 6: 90,378,837 H443Y probably damaging Het
Other mutations in Olfr713
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr713 APN 7 107036847 missense probably damaging 0.99
IGL01630:Olfr713 APN 7 107037111 utr 3 prime probably benign
IGL02539:Olfr713 APN 7 107036434 missense probably damaging 1.00
IGL02727:Olfr713 APN 7 107036695 missense probably damaging 1.00
IGL03336:Olfr713 APN 7 107036335 missense probably damaging 1.00
R0501:Olfr713 UTSW 7 107036232 missense probably benign
R0684:Olfr713 UTSW 7 107036682 missense probably damaging 1.00
R0909:Olfr713 UTSW 7 107036194 missense probably benign 0.19
R1481:Olfr713 UTSW 7 107036149 missense probably benign 0.05
R1958:Olfr713 UTSW 7 107036271 missense possibly damaging 0.77
R1965:Olfr713 UTSW 7 107036358 missense probably damaging 1.00
R2119:Olfr713 UTSW 7 107036731 missense probably damaging 1.00
R2149:Olfr713 UTSW 7 107036338 missense possibly damaging 0.68
R3012:Olfr713 UTSW 7 107036362 missense possibly damaging 0.79
R3428:Olfr713 UTSW 7 107036716 missense probably benign
R4425:Olfr713 UTSW 7 107036491 missense probably damaging 1.00
R4795:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4796:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4908:Olfr713 UTSW 7 107036157 start codon destroyed probably benign 0.02
R4945:Olfr713 UTSW 7 107036319 missense probably benign 0.00
R5122:Olfr713 UTSW 7 107036848 nonsense probably null
R5721:Olfr713 UTSW 7 107036358 missense probably damaging 1.00
R5979:Olfr713 UTSW 7 107036336 missense probably damaging 1.00
R6739:Olfr713 UTSW 7 107036811 missense probably damaging 1.00
R6981:Olfr713 UTSW 7 107036749 missense possibly damaging 0.77
R7228:Olfr713 UTSW 7 107037100 missense probably benign
R7444:Olfr713 UTSW 7 107036347 missense probably damaging 1.00
R8830:Olfr713 UTSW 7 107036682 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CGCTGGCTTTATGACTTCGC -3'
(R):5'- GAAATACATGGGGCTTTGCAGC -3'

Sequencing Primer
(F):5'- CCATTAGATATGACCGTGCCGTTAG -3'
(R):5'- CTTTGCAGCATGGGGTCAGC -3'
Posted On2019-06-26