Incidental Mutation 'R7197:Igsf5'
ID 560048
Institutional Source Beutler Lab
Gene Symbol Igsf5
Ensembl Gene ENSMUSG00000000159
Gene Name immunoglobulin superfamily, member 5
Synonyms Igsf5, Jam4, 2010003D20Rik
MMRRC Submission 045276-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R7197 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 96162868-96223321 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 96204546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 366 (N366K)
Ref Sequence ENSEMBL: ENSMUSP00000000163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000163] [ENSMUST00000081093] [ENSMUST00000113794] [ENSMUST00000113795] [ENSMUST00000136292]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000000163
AA Change: N366K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000163
Gene: ENSMUSG00000000159
AA Change: N366K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081093
AA Change: N266K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079874
Gene: ENSMUSG00000000159
AA Change: N266K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113794
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113795
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136292
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,165,505 (GRCm39) probably null Het
Aars2 T C 17: 45,819,885 (GRCm39) Y221H probably damaging Het
Abca8b G A 11: 109,836,648 (GRCm39) R1216* probably null Het
Acad8 A T 9: 26,888,967 (GRCm39) probably null Het
Acer2 A G 4: 86,805,287 (GRCm39) T84A probably null Het
Adgrb2 A G 4: 129,903,315 (GRCm39) N613S probably damaging Het
Arap2 T C 5: 62,798,729 (GRCm39) D1300G possibly damaging Het
Castor1 T C 11: 4,168,949 (GRCm39) C39R probably damaging Het
Ccl11 A T 11: 81,948,665 (GRCm39) probably benign Het
Cfh A T 1: 140,016,505 (GRCm39) Y1151* probably null Het
Cobll1 A G 2: 64,928,882 (GRCm39) S815P probably benign Het
Cryz T C 3: 154,327,205 (GRCm39) S240P probably damaging Het
Csmd2 A G 4: 128,404,826 (GRCm39) Y2404C Het
F13a1 T C 13: 37,100,860 (GRCm39) D428G probably damaging Het
Fbxo42 A G 4: 140,927,396 (GRCm39) S559G probably benign Het
Fry A G 5: 150,393,232 (GRCm39) S263G Het
Fshr C T 17: 89,292,897 (GRCm39) A594T probably damaging Het
Gm1527 A G 3: 28,980,690 (GRCm39) M597V probably null Het
Gpr158 A T 2: 21,815,412 (GRCm39) T602S probably damaging Het
Hmgxb4 C A 8: 75,756,624 (GRCm39) T583K probably damaging Het
Igkv8-30 C T 6: 70,094,069 (GRCm39) C114Y probably damaging Het
Kif15 T C 9: 122,838,991 (GRCm39) probably null Het
Klk1b26 T A 7: 43,665,821 (GRCm39) probably null Het
Lama1 G T 17: 68,044,700 (GRCm39) E200* probably null Het
Lpar5 C T 6: 125,059,347 (GRCm39) T356I probably benign Het
Lrch3 A T 16: 32,810,665 (GRCm39) T538S probably damaging Het
Mansc4 A G 6: 146,977,203 (GRCm39) S138P probably damaging Het
Mief1 T C 15: 80,134,061 (GRCm39) S373P possibly damaging Het
Nbas G T 12: 13,570,751 (GRCm39) V2053F possibly damaging Het
Nek11 T C 9: 105,121,614 (GRCm39) E435G probably damaging Het
Nynrin A T 14: 56,109,380 (GRCm39) I1496F probably benign Het
Odf1 A T 15: 38,219,794 (GRCm39) M41L probably benign Het
Or10a5 A G 7: 106,635,364 (GRCm39) M8V probably benign Het
Or4c115 A G 2: 88,927,626 (GRCm39) V215A probably benign Het
Or4c29 A T 2: 88,740,708 (GRCm39) F10I probably benign Het
Or7h8 T G 9: 20,123,851 (GRCm39) S69A probably benign Het
Oxnad1 T C 14: 31,818,473 (GRCm39) V106A possibly damaging Het
Padi4 C A 4: 140,488,969 (GRCm39) E157* probably null Het
Parp10 A T 15: 76,126,616 (GRCm39) F217L probably damaging Het
Pcdhb18 T A 18: 37,623,436 (GRCm39) S255R probably benign Het
Pde4c G T 8: 71,197,978 (GRCm39) G102W probably damaging Het
Pde6a T C 18: 61,391,295 (GRCm39) Y547H probably damaging Het
Phf11b A T 14: 59,563,507 (GRCm39) L137I probably benign Het
Pigh A C 12: 79,130,463 (GRCm39) I134S probably damaging Het
Pigt G A 2: 164,344,436 (GRCm39) V362M probably damaging Het
Pld1 A G 3: 28,078,401 (GRCm39) D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 (GRCm39) R282G probably damaging Het
Ppp2r5d A G 17: 46,996,527 (GRCm39) V382A probably damaging Het
Prdm16 T C 4: 154,425,967 (GRCm39) E606G probably damaging Het
Psg28 A G 7: 18,164,509 (GRCm39) Y68H probably damaging Het
Qpctl C A 7: 18,882,944 (GRCm39) W56L probably damaging Het
Rab11fip5 G A 6: 85,319,137 (GRCm39) P584L probably damaging Het
Sde2 C T 1: 180,678,843 (GRCm39) H36Y probably benign Het
Sema4d T C 13: 51,856,872 (GRCm39) S787G probably benign Het
Sgca C T 11: 94,864,014 (GRCm39) probably null Het
Shroom3 A G 5: 93,090,463 (GRCm39) E1071G probably damaging Het
Skint5 A G 4: 113,437,679 (GRCm39) probably null Het
Slc44a3 T A 3: 121,319,411 (GRCm39) D110V probably benign Het
Slc4a4 A C 5: 89,082,433 (GRCm39) probably benign Het
Slc4a8 A G 15: 100,688,857 (GRCm39) D389G probably damaging Het
Sp3 C G 2: 72,809,953 (GRCm39) E11Q probably benign Het
Srrm2 A G 17: 24,037,198 (GRCm39) S1281G unknown Het
Tat A T 8: 110,723,459 (GRCm39) I316F probably benign Het
Thoc5 A G 11: 4,865,563 (GRCm39) T381A probably benign Het
Tiam1 T C 16: 89,681,826 (GRCm39) Y384C probably damaging Het
Tmem45a A T 16: 56,632,026 (GRCm39) F197L probably damaging Het
Trav8d-1 A G 14: 53,016,435 (GRCm39) Y107C probably damaging Het
Trim10 T A 17: 37,187,846 (GRCm39) V354D probably damaging Het
Unc45b A T 11: 82,831,013 (GRCm39) probably null Het
Unc79 A G 12: 103,078,765 (GRCm39) I1643M probably benign Het
Unc80 G T 1: 66,560,725 (GRCm39) G818* probably null Het
Usp15 A T 10: 122,966,910 (GRCm39) M470K possibly damaging Het
Vldlr T C 19: 27,212,241 (GRCm39) V85A probably benign Het
Vma21-ps A G 4: 52,496,994 (GRCm39) V84A probably benign Het
Vmn2r67 C T 7: 84,785,774 (GRCm39) V744I possibly damaging Het
Wdr73 A G 7: 80,542,946 (GRCm39) C221R probably benign Het
Zxdc C T 6: 90,355,819 (GRCm39) H443Y probably damaging Het
Other mutations in Igsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Igsf5 APN 16 96,192,220 (GRCm39) missense possibly damaging 0.72
IGL01335:Igsf5 APN 16 96,174,353 (GRCm39) splice site probably benign
IGL02576:Igsf5 APN 16 96,187,781 (GRCm39) missense probably benign 0.23
IGL02721:Igsf5 APN 16 96,192,222 (GRCm39) missense probably damaging 0.98
IGL03289:Igsf5 APN 16 96,326,632 (GRCm39) missense possibly damaging 0.94
R0630:Igsf5 UTSW 16 96,174,023 (GRCm39) splice site probably benign
R1858:Igsf5 UTSW 16 96,187,829 (GRCm39) splice site probably null
R1961:Igsf5 UTSW 16 96,179,551 (GRCm39) missense probably damaging 1.00
R2508:Igsf5 UTSW 16 96,165,247 (GRCm39) missense probably benign 0.01
R4491:Igsf5 UTSW 16 96,165,281 (GRCm39) missense probably benign 0.02
R5123:Igsf5 UTSW 16 96,174,279 (GRCm39) missense probably damaging 1.00
R5262:Igsf5 UTSW 16 96,192,237 (GRCm39) nonsense probably null
R5384:Igsf5 UTSW 16 96,192,226 (GRCm39) missense probably benign 0.21
R5558:Igsf5 UTSW 16 96,187,731 (GRCm39) missense possibly damaging 0.95
R5950:Igsf5 UTSW 16 96,174,072 (GRCm39) missense probably benign 0.07
R5957:Igsf5 UTSW 16 96,165,249 (GRCm39) missense probably benign 0.10
R6199:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
R6298:Igsf5 UTSW 16 96,197,648 (GRCm39) missense possibly damaging 0.93
R7164:Igsf5 UTSW 16 96,174,048 (GRCm39) missense possibly damaging 0.85
R8213:Igsf5 UTSW 16 96,174,188 (GRCm39) missense probably damaging 1.00
R8353:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8453:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8823:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
R9798:Igsf5 UTSW 16 96,174,075 (GRCm39) missense probably damaging 1.00
Z1176:Igsf5 UTSW 16 96,192,223 (GRCm39) missense probably damaging 1.00
Z1177:Igsf5 UTSW 16 96,179,533 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGTGCATCTTCCCAGGTTAG -3'
(R):5'- GCCACCTTGAGGAATTCACC -3'

Sequencing Primer
(F):5'- TCCCAGGTTAGTGTCTCTCAG -3'
(R):5'- CCAAATACTTCTTGGAATACAGGG -3'
Posted On 2019-06-26