Incidental Mutation 'R7197:Fshr'
ID560054
Institutional Source Beutler Lab
Gene Symbol Fshr
Ensembl Gene ENSMUSG00000032937
Gene Namefollicle stimulating hormone receptor
SynonymsFSH-R, Follitropin receptor, follicle-stimulating hormone receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7197 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location88985170-89200612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88985469 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 594 (A594T)
Ref Sequence ENSEMBL: ENSMUSP00000040477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035701]
Predicted Effect probably damaging
Transcript: ENSMUST00000035701
AA Change: A594T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040477
Gene: ENSMUSG00000032937
AA Change: A594T

DomainStartEndE-ValueType
LRRNT 17 50 3.93e-3 SMART
Pfam:LRR_5 134 249 9e-7 PFAM
Pfam:GnHR_trans 282 348 4.6e-27 PFAM
Pfam:7tm_1 378 625 1.9e-30 PFAM
Meta Mutation Damage Score 0.8798 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to family 1 of G-protein coupled receptors. It is the receptor for follicle stimulating hormone and functions in gonad development. Mutations in this gene cause ovarian dysgenesis type 1, and also ovarian hyperstimulation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mutant females are sterile with small ovaries, blocked follicular development, atrophic uterus and imperforate vagina. Mutant males are fertile despite reduction in testis weight, oligozoospermia and reduced testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
Aars2 T C 17: 45,508,959 Y221H probably damaging Het
Abca8b G A 11: 109,945,822 R1216* probably null Het
Acad8 A T 9: 26,977,671 probably null Het
Acer2 A G 4: 86,887,050 T84A probably null Het
Adgrb2 A G 4: 130,009,522 N613S probably damaging Het
Arap2 T C 5: 62,641,386 D1300G possibly damaging Het
Ccl11 A T 11: 82,057,839 probably benign Het
Cfh A T 1: 140,088,767 Y1151* probably null Het
Cobll1 A G 2: 65,098,538 S815P probably benign Het
Cryz T C 3: 154,621,568 S240P probably damaging Het
Csmd2 A G 4: 128,511,033 Y2404C Het
F13a1 T C 13: 36,916,886 D428G probably damaging Het
Fbxo42 A G 4: 141,200,085 S559G probably benign Het
Fry A G 5: 150,469,767 S263G Het
Gatsl3 T C 11: 4,218,949 C39R probably damaging Het
Gm1527 A G 3: 28,926,541 M597V probably null Het
Gpr158 A T 2: 21,810,601 T602S probably damaging Het
Hmgxb4 C A 8: 75,029,996 T583K probably damaging Het
Igkv8-30 C T 6: 70,117,085 C114Y probably damaging Het
Igsf5 T A 16: 96,403,346 N366K probably damaging Het
Kif15 T C 9: 123,009,926 probably null Het
Klk1b26 T A 7: 44,016,397 probably null Het
Lama1 G T 17: 67,737,705 E200* probably null Het
Lpar5 C T 6: 125,082,384 T356I probably benign Het
Lrch3 A T 16: 32,990,295 T538S probably damaging Het
Mansc4 A G 6: 147,075,705 S138P probably damaging Het
Mief1 T C 15: 80,249,860 S373P possibly damaging Het
Nbas G T 12: 13,520,750 V2053F possibly damaging Het
Nek11 T C 9: 105,244,415 E435G probably damaging Het
Nynrin A T 14: 55,871,923 I1496F probably benign Het
Odf1 A T 15: 38,219,550 M41L probably benign Het
Olfr1209 A T 2: 88,910,364 F10I probably benign Het
Olfr1220 A G 2: 89,097,282 V215A probably benign Het
Olfr713 A G 7: 107,036,157 M8V probably benign Het
Olfr871 T G 9: 20,212,555 S69A probably benign Het
Oxnad1 T C 14: 32,096,516 V106A possibly damaging Het
Padi4 C A 4: 140,761,658 E157* probably null Het
Parp10 A T 15: 76,242,416 F217L probably damaging Het
Pcdhb18 T A 18: 37,490,383 S255R probably benign Het
Pde4c G T 8: 70,745,329 G102W probably damaging Het
Pde6a T C 18: 61,258,224 Y547H probably damaging Het
Phf11b A T 14: 59,326,058 L137I probably benign Het
Pigh A C 12: 79,083,689 I134S probably damaging Het
Pigt G A 2: 164,502,516 V362M probably damaging Het
Pld1 A G 3: 28,024,252 D20G probably damaging Het
Pou3f2 T C 4: 22,487,288 R282G probably damaging Het
Ppp2r5d A G 17: 46,685,601 V382A probably damaging Het
Prdm16 T C 4: 154,341,510 E606G probably damaging Het
Psg28 A G 7: 18,430,584 Y68H probably damaging Het
Qpctl C A 7: 19,149,019 W56L probably damaging Het
Rab11fip5 G A 6: 85,342,155 P584L probably damaging Het
Sde2 C T 1: 180,851,278 H36Y probably benign Het
Sema4d T C 13: 51,702,836 S787G probably benign Het
Sgca C T 11: 94,973,188 probably null Het
Shroom3 A G 5: 92,942,604 E1071G probably damaging Het
Skint5 A G 4: 113,580,482 probably null Het
Slc44a3 T A 3: 121,525,762 D110V probably benign Het
Slc4a4 A C 5: 88,934,574 probably benign Het
Slc4a8 A G 15: 100,790,976 D389G probably damaging Het
Sp3 C G 2: 72,979,609 E11Q probably benign Het
Srrm2 A G 17: 23,818,224 S1281G unknown Het
Tat A T 8: 109,996,827 I316F probably benign Het
Thoc5 A G 11: 4,915,563 T381A probably benign Het
Tiam1 T C 16: 89,884,938 Y384C probably damaging Het
Tmem45a A T 16: 56,811,663 F197L probably damaging Het
Trav8d-1 A G 14: 52,778,978 Y107C probably damaging Het
Trim10 T A 17: 36,876,954 V354D probably damaging Het
Unc45b A T 11: 82,940,187 probably null Het
Unc79 A G 12: 103,112,506 I1643M probably benign Het
Unc80 G T 1: 66,521,566 G818* probably null Het
Usp15 A T 10: 123,131,005 M470K possibly damaging Het
Vldlr T C 19: 27,234,841 V85A probably benign Het
Vma21-ps A G 4: 52,496,994 V84A probably benign Het
Vmn2r67 C T 7: 85,136,566 V744I possibly damaging Het
Wdr73 A G 7: 80,893,198 C221R probably benign Het
Zxdc C T 6: 90,378,837 H443Y probably damaging Het
Other mutations in Fshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Fshr APN 17 88986191 missense probably damaging 1.00
IGL00272:Fshr APN 17 88985271 missense probably benign 0.00
IGL01067:Fshr APN 17 88985393 missense possibly damaging 0.95
IGL02093:Fshr APN 17 89001889 splice site probably null
IGL03184:Fshr APN 17 89046640 missense possibly damaging 0.80
IGL03383:Fshr APN 17 89046699 missense possibly damaging 0.69
IGL03383:Fshr APN 17 88985693 missense probably damaging 0.98
benedict UTSW 17 88985469 missense probably damaging 1.00
incremental UTSW 17 88985986 missense probably damaging 1.00
positively UTSW 17 88988607 missense probably damaging 1.00
R0056:Fshr UTSW 17 88988457 missense probably damaging 1.00
R0119:Fshr UTSW 17 89009285 missense probably benign 0.34
R0299:Fshr UTSW 17 89009285 missense probably benign 0.34
R0499:Fshr UTSW 17 89009285 missense probably benign 0.34
R0550:Fshr UTSW 17 89045125 missense probably benign 0.00
R1499:Fshr UTSW 17 88986101 missense probably damaging 1.00
R1656:Fshr UTSW 17 89200581 missense unknown
R2435:Fshr UTSW 17 89200596 missense unknown
R3730:Fshr UTSW 17 89001715 missense probably benign 0.00
R3928:Fshr UTSW 17 88985534 missense probably damaging 1.00
R4065:Fshr UTSW 17 88985966 missense probably damaging 1.00
R4625:Fshr UTSW 17 88985720 missense probably damaging 1.00
R5062:Fshr UTSW 17 88986046 nonsense probably null
R5103:Fshr UTSW 17 89097368 missense possibly damaging 0.88
R5212:Fshr UTSW 17 88986256 missense probably benign 0.00
R5212:Fshr UTSW 17 88986257 missense probably benign 0.04
R5311:Fshr UTSW 17 89011013 critical splice donor site probably null
R5456:Fshr UTSW 17 88986348 missense probably benign
R5478:Fshr UTSW 17 89001715 missense probably benign 0.00
R5577:Fshr UTSW 17 88985923 missense probably benign 0.00
R5651:Fshr UTSW 17 88985829 missense possibly damaging 0.62
R5715:Fshr UTSW 17 88986396 critical splice acceptor site probably null
R5750:Fshr UTSW 17 88986241 missense probably benign 0.01
R5797:Fshr UTSW 17 89011075 missense probably damaging 1.00
R6041:Fshr UTSW 17 88985986 missense probably damaging 1.00
R6306:Fshr UTSW 17 89200533 missense probably null 0.00
R6589:Fshr UTSW 17 88988607 missense probably damaging 1.00
R6955:Fshr UTSW 17 88985466 missense probably benign 0.00
R7080:Fshr UTSW 17 89097111 intron probably null
R7139:Fshr UTSW 17 88986161 missense possibly damaging 0.46
R7196:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7289:Fshr UTSW 17 88985844 missense probably benign 0.35
R7480:Fshr UTSW 17 88985374 nonsense probably null
R7562:Fshr UTSW 17 88988497 missense probably damaging 1.00
R7710:Fshr UTSW 17 88985255 missense probably benign 0.00
R7742:Fshr UTSW 17 88986162 missense probably benign
R7821:Fshr UTSW 17 88986213 missense probably damaging 0.99
R8043:Fshr UTSW 17 88986390 missense probably benign 0.06
Z1176:Fshr UTSW 17 89046667 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTGCACCTCATAACAGCC -3'
(R):5'- CTGCCCATGGATATCGACAG -3'

Sequencing Primer
(F):5'- GCCAAACTTGCTCATCAGGACG -3'
(R):5'- ATGGATATCGACAGCCCTTTG -3'
Posted On2019-06-26