Incidental Mutation 'R7198:Kcnd3'
ID560068
Institutional Source Beutler Lab
Gene Symbol Kcnd3
Ensembl Gene ENSMUSG00000040896
Gene Namepotassium voltage-gated channel, Shal-related family, member 3
SynonymsKv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7198 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location105452330-105674002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105459540 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 242 (L242P)
Ref Sequence ENSEMBL: ENSMUSP00000078169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]
Predicted Effect probably damaging
Transcript: ENSMUST00000079169
AA Change: L242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: L242P

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098761
AA Change: L242P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: L242P

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118360
AA Change: L242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: L242P

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Meta Mutation Damage Score 0.9682 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,078,655 S365N probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b A G 2: 59,962,206 L526P probably benign Het
Bbs1 A T 19: 4,895,015 L376Q probably damaging Het
Bcl9 T A 3: 97,205,195 M1315L possibly damaging Het
Bcl9 T C 3: 97,208,867 Q837R probably damaging Het
Cct2 A G 10: 117,053,124 V490A probably benign Het
Cdh23 T C 10: 60,312,599 Y2663C possibly damaging Het
Chit1 A G 1: 134,150,491 K346E possibly damaging Het
Chl1 A G 6: 103,706,556 Y781C probably damaging Het
Col12a1 A C 9: 79,650,032 L1938R possibly damaging Het
Cpxm2 T A 7: 132,080,084 N239Y probably damaging Het
Cyp3a41b A G 5: 145,582,520 Y54H probably benign Het
Dclk1 A C 3: 55,477,875 D369A possibly damaging Het
Dpy19l3 T C 7: 35,749,765 N71S possibly damaging Het
Fer T A 17: 63,921,688 V186E possibly damaging Het
Gm11042 T A 12: 74,315,114 H39L unknown Het
Gm11639 T A 11: 104,751,885 N1111K probably benign Het
Gm14325 A G 2: 177,832,005 I428T probably benign Het
Gm47995 A G 1: 151,198,653 E69G possibly damaging Het
Gm6176 T A 7: 22,051,171 I112F probably damaging Het
Hivep2 T A 10: 14,129,966 D769E probably benign Het
Hsdl1 C T 8: 119,567,868 V40I probably benign Het
Ipmk A G 10: 71,348,052 H34R probably damaging Het
Kdm4d T C 9: 14,464,020 M181V probably damaging Het
Lats2 A T 14: 57,697,125 I716N probably damaging Het
Liph T C 16: 21,966,022 Y305C probably damaging Het
Ltbp1 T C 17: 75,226,967 V150A possibly damaging Het
Ly6d A T 15: 74,762,535 S69T probably benign Het
Meltf A G 16: 31,883,799 R115G possibly damaging Het
Msgn1 G T 12: 11,208,901 D16E probably benign Het
Mthfd2l T A 5: 90,946,846 I58K probably damaging Het
Mup18 G C 4: 61,673,336 probably null Het
Nek10 T A 14: 14,850,947 W331R probably damaging Het
Nphp3 A G 9: 104,004,775 Y148C probably damaging Het
Olfr1256 T C 2: 89,835,732 Y71C probably damaging Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr820 T A 10: 130,017,891 C177S probably damaging Het
Oscp1 A G 4: 126,086,666 T325A possibly damaging Het
Pcdha4 T A 18: 36,953,560 N265K probably damaging Het
Pigq C T 17: 25,934,225 V331I probably benign Het
Plekhg4 A G 8: 105,378,697 E598G probably damaging Het
Pou6f2 G A 13: 18,129,163 T120M probably damaging Het
Psg27 T A 7: 18,561,801 T240S probably damaging Het
Samd12 T A 15: 53,860,253 I15F probably damaging Het
Scaf4 A T 16: 90,252,430 D256E unknown Het
Scaf8 T A 17: 3,163,098 M154K unknown Het
Slc27a1 T C 8: 71,579,427 V64A possibly damaging Het
Smc5 G A 19: 23,259,700 R256* probably null Het
Snx31 A G 15: 36,555,310 F31L probably benign Het
Spag17 T C 3: 100,095,572 S1871P probably benign Het
Tdpoz4 T G 3: 93,797,355 S320A probably benign Het
Tmprss11c A T 5: 86,231,832 C406S probably damaging Het
Tnip1 G A 11: 54,917,804 A519V probably benign Het
Tssc4 T A 7: 143,070,987 probably null Het
Uba3 A T 6: 97,205,551 M1K probably null Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Wdr78 A G 4: 103,062,413 V498A probably damaging Het
Wnt11 T C 7: 98,847,381 M176T possibly damaging Het
Wrn C T 8: 33,324,318 G366D probably benign Het
Xylt1 T A 7: 117,656,584 I793N probably damaging Het
Zfp677 T G 17: 21,398,417 C579G probably damaging Het
Zscan4-ps1 T A 7: 11,065,699 K421M probably damaging Het
Other mutations in Kcnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Kcnd3 APN 3 105667001 nonsense probably null
PIT4498001:Kcnd3 UTSW 3 105658709 missense probably damaging 0.99
R0483:Kcnd3 UTSW 3 105459626 missense probably damaging 1.00
R0544:Kcnd3 UTSW 3 105658759 missense probably damaging 1.00
R1457:Kcnd3 UTSW 3 105668186 missense probably benign 0.00
R1853:Kcnd3 UTSW 3 105459752 missense probably damaging 1.00
R2030:Kcnd3 UTSW 3 105459537 missense probably damaging 1.00
R2077:Kcnd3 UTSW 3 105666999 missense probably benign 0.16
R2106:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2287:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2288:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2316:Kcnd3 UTSW 3 105669126 missense probably benign 0.17
R2909:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2924:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2925:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3014:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3016:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3038:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3696:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3697:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3698:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3777:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3778:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3785:Kcnd3 UTSW 3 105668225 missense possibly damaging 0.79
R3810:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3811:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3815:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3816:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3819:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3877:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3879:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3899:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4300:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4367:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4370:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4491:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4549:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4550:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4569:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4571:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4593:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4594:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4595:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4624:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4625:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4627:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4630:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4631:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4632:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4799:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4822:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R5021:Kcnd3 UTSW 3 105658754 missense probably damaging 1.00
R5056:Kcnd3 UTSW 3 105666928 intron probably benign
R5849:Kcnd3 UTSW 3 105458795 utr 5 prime probably benign
R7224:Kcnd3 UTSW 3 105669084 missense probably damaging 0.98
R7532:Kcnd3 UTSW 3 105668210 missense probably damaging 1.00
R7578:Kcnd3 UTSW 3 105459617 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGCTTCCGTCAGACCATGTG -3'
(R):5'- CTTGAAGATCCTGAAGACACGG -3'

Sequencing Primer
(F):5'- GGCACTGGTCTTCTACTATGTGAC -3'
(R):5'- GATCCTGAAGACACGGAAGACC -3'
Posted On2019-06-26