Incidental Mutation 'R7198:Wrn'
ID560083
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene NameWerner syndrome RecQ like helicase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R7198 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location33234384-33385527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33324318 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 366 (G366D)
Ref Sequence ENSEMBL: ENSMUSP00000033990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]
PDB Structure
structure of mouse WRN exonuclease domain [X-RAY DIFFRACTION]
structure of mouse werner exonuclease domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033990
AA Change: G366D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: G366D

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033991
AA Change: G366D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: G366D

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211498
AA Change: G123D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,078,655 S365N probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b A G 2: 59,962,206 L526P probably benign Het
Bbs1 A T 19: 4,895,015 L376Q probably damaging Het
Bcl9 T A 3: 97,205,195 M1315L possibly damaging Het
Bcl9 T C 3: 97,208,867 Q837R probably damaging Het
Cct2 A G 10: 117,053,124 V490A probably benign Het
Cdh23 T C 10: 60,312,599 Y2663C possibly damaging Het
Chit1 A G 1: 134,150,491 K346E possibly damaging Het
Chl1 A G 6: 103,706,556 Y781C probably damaging Het
Col12a1 A C 9: 79,650,032 L1938R possibly damaging Het
Cpxm2 T A 7: 132,080,084 N239Y probably damaging Het
Cyp3a41b A G 5: 145,582,520 Y54H probably benign Het
Dclk1 A C 3: 55,477,875 D369A possibly damaging Het
Dpy19l3 T C 7: 35,749,765 N71S possibly damaging Het
Fer T A 17: 63,921,688 V186E possibly damaging Het
Gm11042 T A 12: 74,315,114 H39L unknown Het
Gm11639 T A 11: 104,751,885 N1111K probably benign Het
Gm14325 A G 2: 177,832,005 I428T probably benign Het
Gm47995 A G 1: 151,198,653 E69G possibly damaging Het
Gm6176 T A 7: 22,051,171 I112F probably damaging Het
Hivep2 T A 10: 14,129,966 D769E probably benign Het
Hsdl1 C T 8: 119,567,868 V40I probably benign Het
Ipmk A G 10: 71,348,052 H34R probably damaging Het
Kcnd3 T C 3: 105,459,540 L242P probably damaging Het
Kdm4d T C 9: 14,464,020 M181V probably damaging Het
Lats2 A T 14: 57,697,125 I716N probably damaging Het
Liph T C 16: 21,966,022 Y305C probably damaging Het
Ltbp1 T C 17: 75,226,967 V150A possibly damaging Het
Ly6d A T 15: 74,762,535 S69T probably benign Het
Meltf A G 16: 31,883,799 R115G possibly damaging Het
Msgn1 G T 12: 11,208,901 D16E probably benign Het
Mthfd2l T A 5: 90,946,846 I58K probably damaging Het
Mup18 G C 4: 61,673,336 probably null Het
Nek10 T A 14: 14,850,947 W331R probably damaging Het
Nphp3 A G 9: 104,004,775 Y148C probably damaging Het
Olfr1256 T C 2: 89,835,732 Y71C probably damaging Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr820 T A 10: 130,017,891 C177S probably damaging Het
Oscp1 A G 4: 126,086,666 T325A possibly damaging Het
Pcdha4 T A 18: 36,953,560 N265K probably damaging Het
Pigq C T 17: 25,934,225 V331I probably benign Het
Plekhg4 A G 8: 105,378,697 E598G probably damaging Het
Pou6f2 G A 13: 18,129,163 T120M probably damaging Het
Psg27 T A 7: 18,561,801 T240S probably damaging Het
Samd12 T A 15: 53,860,253 I15F probably damaging Het
Scaf4 A T 16: 90,252,430 D256E unknown Het
Scaf8 T A 17: 3,163,098 M154K unknown Het
Slc27a1 T C 8: 71,579,427 V64A possibly damaging Het
Smc5 G A 19: 23,259,700 R256* probably null Het
Snx31 A G 15: 36,555,310 F31L probably benign Het
Spag17 T C 3: 100,095,572 S1871P probably benign Het
Tdpoz4 T G 3: 93,797,355 S320A probably benign Het
Tmprss11c A T 5: 86,231,832 C406S probably damaging Het
Tnip1 G A 11: 54,917,804 A519V probably benign Het
Tssc4 T A 7: 143,070,987 probably null Het
Uba3 A T 6: 97,205,551 M1K probably null Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Wdr78 A G 4: 103,062,413 V498A probably damaging Het
Wnt11 T C 7: 98,847,381 M176T possibly damaging Het
Xylt1 T A 7: 117,656,584 I793N probably damaging Het
Zfp677 T G 17: 21,398,417 C579G probably damaging Het
Zscan4-ps1 T A 7: 11,065,699 K421M probably damaging Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33322377 splice site probably benign
IGL00661:Wrn APN 8 33319145 splice site probably benign
IGL01472:Wrn APN 8 33329172 missense possibly damaging 0.93
IGL01544:Wrn APN 8 33324526 missense probably benign 0.00
IGL01599:Wrn APN 8 33241011 missense possibly damaging 0.69
IGL01688:Wrn APN 8 33310702 splice site probably benign
IGL01916:Wrn APN 8 33257224 missense possibly damaging 0.78
IGL01925:Wrn APN 8 33319180 missense probably benign 0.42
IGL02068:Wrn APN 8 33310749 missense probably benign 0.38
IGL02084:Wrn APN 8 33285179 missense probably benign
IGL02167:Wrn APN 8 33317555 missense probably damaging 1.00
IGL02230:Wrn APN 8 33317563 missense probably damaging 1.00
IGL02717:Wrn APN 8 33343573 missense probably damaging 1.00
IGL02982:Wrn APN 8 33343066 missense probably damaging 1.00
IGL03030:Wrn APN 8 33248961 missense possibly damaging 0.94
IGL03088:Wrn APN 8 33268823 splice site probably benign
IGL03179:Wrn APN 8 33310706 splice site probably null
IGL03306:Wrn APN 8 33336121 missense probably damaging 1.00
R0004:Wrn UTSW 8 33317560 missense probably damaging 1.00
R0190:Wrn UTSW 8 33240983 missense probably benign 0.02
R0441:Wrn UTSW 8 33268750 missense probably benign 0.24
R0463:Wrn UTSW 8 33280815 missense possibly damaging 0.84
R0538:Wrn UTSW 8 33336091 missense probably damaging 0.99
R0682:Wrn UTSW 8 33267820 missense probably benign 0.00
R0729:Wrn UTSW 8 33248918 splice site probably null
R0744:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R0836:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R1168:Wrn UTSW 8 33316408 missense probably damaging 1.00
R1301:Wrn UTSW 8 33292686 missense probably damaging 1.00
R1352:Wrn UTSW 8 33294916 missense probably benign 0.25
R1396:Wrn UTSW 8 33268819 missense probably damaging 1.00
R1432:Wrn UTSW 8 33319141 splice site probably benign
R1523:Wrn UTSW 8 33292716 missense probably benign 0.23
R1625:Wrn UTSW 8 33329130 missense probably benign 0.01
R1664:Wrn UTSW 8 33280766 splice site probably null
R1773:Wrn UTSW 8 33343561 missense probably damaging 1.00
R1864:Wrn UTSW 8 33288864 missense probably damaging 0.99
R1868:Wrn UTSW 8 33257221 missense probably benign 0.03
R2011:Wrn UTSW 8 33236404 missense probably benign 0.02
R2075:Wrn UTSW 8 33322329 missense probably benign 0.00
R2091:Wrn UTSW 8 33267825 missense probably benign
R2213:Wrn UTSW 8 33257015 missense probably benign 0.05
R2255:Wrn UTSW 8 33329202 missense probably benign 0.13
R2276:Wrn UTSW 8 33324556 missense probably benign 0.02
R3177:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3277:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3779:Wrn UTSW 8 33241020 missense probably damaging 1.00
R3827:Wrn UTSW 8 33324520 missense probably benign 0.00
R4111:Wrn UTSW 8 33352155 missense probably benign 0.02
R4392:Wrn UTSW 8 33251832 missense probably damaging 0.99
R4458:Wrn UTSW 8 33294998 missense probably damaging 0.99
R4650:Wrn UTSW 8 33255509 missense probably benign 0.05
R4656:Wrn UTSW 8 33335991 splice site probably null
R4657:Wrn UTSW 8 33335991 splice site probably null
R4667:Wrn UTSW 8 33324338 missense probably benign 0.00
R4735:Wrn UTSW 8 33285222 missense probably damaging 1.00
R4933:Wrn UTSW 8 33322343 missense probably benign 0.01
R5104:Wrn UTSW 8 33267867 splice site probably null
R5166:Wrn UTSW 8 33352072 critical splice donor site probably null
R5279:Wrn UTSW 8 33241101 missense probably damaging 1.00
R5400:Wrn UTSW 8 33294917 missense probably benign 0.02
R5575:Wrn UTSW 8 33336130 missense probably benign 0.02
R5695:Wrn UTSW 8 33324318 missense probably benign 0.26
R5729:Wrn UTSW 8 33268778 missense probably benign 0.02
R6044:Wrn UTSW 8 33236429 missense probably damaging 1.00
R6139:Wrn UTSW 8 33353332 missense probably damaging 1.00
R6158:Wrn UTSW 8 33319172 missense probably damaging 1.00
R6192:Wrn UTSW 8 33284654 missense probably benign 0.12
R6243:Wrn UTSW 8 33284654 missense possibly damaging 0.94
R6354:Wrn UTSW 8 33343638 missense possibly damaging 0.93
R6429:Wrn UTSW 8 33342996 missense probably damaging 1.00
R6490:Wrn UTSW 8 33319220 missense probably benign 0.01
R6529:Wrn UTSW 8 33335976 splice site probably null
R6535:Wrn UTSW 8 33336103 missense probably damaging 0.99
R7001:Wrn UTSW 8 33352129 missense probably benign 0.04
R7114:Wrn UTSW 8 33285121 frame shift probably null
R7200:Wrn UTSW 8 33322348 missense probably benign 0.00
R7227:Wrn UTSW 8 33248946 missense probably damaging 1.00
R7299:Wrn UTSW 8 33292718 missense probably damaging 1.00
R7374:Wrn UTSW 8 33268911 missense probably damaging 1.00
R7402:Wrn UTSW 8 33248966 missense probably benign 0.00
R7404:Wrn UTSW 8 33248966 missense probably benign 0.00
R7405:Wrn UTSW 8 33248966 missense probably benign 0.00
R7464:Wrn UTSW 8 33335996 critical splice donor site probably null
R7474:Wrn UTSW 8 33329181 missense probably damaging 0.96
R7609:Wrn UTSW 8 33310713 missense possibly damaging 0.50
R7729:Wrn UTSW 8 33324426 missense probably benign 0.21
R7830:Wrn UTSW 8 33269054 missense probably damaging 0.97
R7998:Wrn UTSW 8 33292643 missense probably benign 0.10
R8239:Wrn UTSW 8 33329185 missense probably damaging 1.00
R8262:Wrn UTSW 8 33324246 missense probably benign 0.07
R8410:Wrn UTSW 8 33269020 missense probably damaging 1.00
RF010:Wrn UTSW 8 33288765 missense probably benign 0.13
X0017:Wrn UTSW 8 33280782 missense probably damaging 1.00
Z1176:Wrn UTSW 8 33334209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTCACAGTATGGATGCCTG -3'
(R):5'- TGAGACTAGACTGAAGCCGG -3'

Sequencing Primer
(F):5'- GTGGATCTCACAAGTTAACATGGCC -3'
(R):5'- GAAGCCGGGCAGTAGTTTTAATTTAC -3'
Posted On2019-06-26