Incidental Mutation 'R7198:Plekhg4'
ID560085
Institutional Source Beutler Lab
Gene Symbol Plekhg4
Ensembl Gene ENSMUSG00000014782
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms4931414L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R7198 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105373274-105382862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105378697 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 598 (E598G)
Ref Sequence ENSEMBL: ENSMUSP00000150574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000160650] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
Predicted Effect probably damaging
Transcript: ENSMUST00000014927
AA Change: E562G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782
AA Change: E562G

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000160191
AA Change: E493G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782
AA Change: E493G

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160650
Predicted Effect probably benign
Transcript: ENSMUST00000167294
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168196
Predicted Effect probably damaging
Transcript: ENSMUST00000214056
AA Change: E598G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1408 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can function as a guanine nucleotide exchange factor (GEF) and may play a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Polymorphisms in the region of this gene have been found to be associated with spinocerebellar ataxia in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,078,655 S365N probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b A G 2: 59,962,206 L526P probably benign Het
Bbs1 A T 19: 4,895,015 L376Q probably damaging Het
Bcl9 T C 3: 97,208,867 Q837R probably damaging Het
Bcl9 T A 3: 97,205,195 M1315L possibly damaging Het
Cct2 A G 10: 117,053,124 V490A probably benign Het
Cdh23 T C 10: 60,312,599 Y2663C possibly damaging Het
Chit1 A G 1: 134,150,491 K346E possibly damaging Het
Chl1 A G 6: 103,706,556 Y781C probably damaging Het
Col12a1 A C 9: 79,650,032 L1938R possibly damaging Het
Cpxm2 T A 7: 132,080,084 N239Y probably damaging Het
Cyp3a41b A G 5: 145,582,520 Y54H probably benign Het
Dclk1 A C 3: 55,477,875 D369A possibly damaging Het
Dpy19l3 T C 7: 35,749,765 N71S possibly damaging Het
Fer T A 17: 63,921,688 V186E possibly damaging Het
Gm11042 T A 12: 74,315,114 H39L unknown Het
Gm11639 T A 11: 104,751,885 N1111K probably benign Het
Gm14325 A G 2: 177,832,005 I428T probably benign Het
Gm47995 A G 1: 151,198,653 E69G possibly damaging Het
Gm6176 T A 7: 22,051,171 I112F probably damaging Het
Hivep2 T A 10: 14,129,966 D769E probably benign Het
Hsdl1 C T 8: 119,567,868 V40I probably benign Het
Ipmk A G 10: 71,348,052 H34R probably damaging Het
Kcnd3 T C 3: 105,459,540 L242P probably damaging Het
Kdm4d T C 9: 14,464,020 M181V probably damaging Het
Lats2 A T 14: 57,697,125 I716N probably damaging Het
Liph T C 16: 21,966,022 Y305C probably damaging Het
Ltbp1 T C 17: 75,226,967 V150A possibly damaging Het
Ly6d A T 15: 74,762,535 S69T probably benign Het
Meltf A G 16: 31,883,799 R115G possibly damaging Het
Msgn1 G T 12: 11,208,901 D16E probably benign Het
Mthfd2l T A 5: 90,946,846 I58K probably damaging Het
Mup18 G C 4: 61,673,336 probably null Het
Nek10 T A 14: 14,850,947 W331R probably damaging Het
Nphp3 A G 9: 104,004,775 Y148C probably damaging Het
Olfr1256 T C 2: 89,835,732 Y71C probably damaging Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr820 T A 10: 130,017,891 C177S probably damaging Het
Oscp1 A G 4: 126,086,666 T325A possibly damaging Het
Pcdha4 T A 18: 36,953,560 N265K probably damaging Het
Pigq C T 17: 25,934,225 V331I probably benign Het
Pou6f2 G A 13: 18,129,163 T120M probably damaging Het
Psg27 T A 7: 18,561,801 T240S probably damaging Het
Samd12 T A 15: 53,860,253 I15F probably damaging Het
Scaf4 A T 16: 90,252,430 D256E unknown Het
Scaf8 T A 17: 3,163,098 M154K unknown Het
Slc27a1 T C 8: 71,579,427 V64A possibly damaging Het
Smc5 G A 19: 23,259,700 R256* probably null Het
Snx31 A G 15: 36,555,310 F31L probably benign Het
Spag17 T C 3: 100,095,572 S1871P probably benign Het
Tdpoz4 T G 3: 93,797,355 S320A probably benign Het
Tmprss11c A T 5: 86,231,832 C406S probably damaging Het
Tnip1 G A 11: 54,917,804 A519V probably benign Het
Tssc4 T A 7: 143,070,987 probably null Het
Uba3 A T 6: 97,205,551 M1K probably null Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Wdr78 A G 4: 103,062,413 V498A probably damaging Het
Wnt11 T C 7: 98,847,381 M176T possibly damaging Het
Wrn C T 8: 33,324,318 G366D probably benign Het
Xylt1 T A 7: 117,656,584 I793N probably damaging Het
Zfp677 T G 17: 21,398,417 C579G probably damaging Het
Zscan4-ps1 T A 7: 11,065,699 K421M probably damaging Het
Other mutations in Plekhg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Plekhg4 APN 8 105375738 missense probably benign 0.01
IGL00970:Plekhg4 APN 8 105378435 missense probably benign 0.02
IGL01784:Plekhg4 APN 8 105378957 missense probably damaging 1.00
IGL02063:Plekhg4 APN 8 105379252 splice site probably benign
IGL02371:Plekhg4 APN 8 105379059 splice site probably null
IGL02984:Plekhg4 UTSW 8 105380388 missense probably damaging 1.00
R0013:Plekhg4 UTSW 8 105375396 nonsense probably null
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0631:Plekhg4 UTSW 8 105379302 missense probably damaging 1.00
R1078:Plekhg4 UTSW 8 105381677 nonsense probably null
R1201:Plekhg4 UTSW 8 105381673 missense probably damaging 1.00
R1222:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1418:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1459:Plekhg4 UTSW 8 105381799 missense probably damaging 0.98
R1465:Plekhg4 UTSW 8 105381040 splice site probably benign
R1558:Plekhg4 UTSW 8 105381835 missense possibly damaging 0.73
R1637:Plekhg4 UTSW 8 105381781 missense probably benign 0.08
R1757:Plekhg4 UTSW 8 105381661 missense probably damaging 0.99
R1922:Plekhg4 UTSW 8 105378385 missense probably damaging 1.00
R1961:Plekhg4 UTSW 8 105381464 missense probably damaging 0.99
R2074:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2113:Plekhg4 UTSW 8 105379434 missense probably damaging 1.00
R2124:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2196:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2321:Plekhg4 UTSW 8 105377540 missense probably benign 0.00
R2432:Plekhg4 UTSW 8 105381836 missense probably benign 0.00
R2908:Plekhg4 UTSW 8 105380861 missense probably damaging 1.00
R2910:Plekhg4 UTSW 8 105376452 small deletion probably benign
R4179:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4180:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4513:Plekhg4 UTSW 8 105380402 missense probably damaging 1.00
R4678:Plekhg4 UTSW 8 105380371 nonsense probably null
R4946:Plekhg4 UTSW 8 105381996 missense probably null 0.01
R5223:Plekhg4 UTSW 8 105378949 missense probably benign 0.18
R5362:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R5454:Plekhg4 UTSW 8 105376113 critical splice donor site probably null
R5609:Plekhg4 UTSW 8 105379502 critical splice donor site probably null
R5624:Plekhg4 UTSW 8 105380750 missense probably damaging 0.99
R5806:Plekhg4 UTSW 8 105378910 missense possibly damaging 0.85
R6297:Plekhg4 UTSW 8 105377840 missense probably damaging 1.00
R7443:Plekhg4 UTSW 8 105380867 missense probably damaging 1.00
R7570:Plekhg4 UTSW 8 105378684 missense possibly damaging 0.95
R7577:Plekhg4 UTSW 8 105375399 missense probably benign
R7632:Plekhg4 UTSW 8 105380150 missense probably damaging 1.00
R7782:Plekhg4 UTSW 8 105377767 missense probably benign 0.14
R7958:Plekhg4 UTSW 8 105376649 missense possibly damaging 0.86
R8239:Plekhg4 UTSW 8 105380914 nonsense probably null
R8335:Plekhg4 UTSW 8 105376216 missense probably damaging 0.97
R8411:Plekhg4 UTSW 8 105377329 nonsense probably null
Z1177:Plekhg4 UTSW 8 105374842 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCAGAGTCTCAATCGGCTTG -3'
(R):5'- CTCACGCTTTTGGTCCAGAG -3'

Sequencing Primer
(F):5'- AGTCTCAATCGGCTTGGTTGC -3'
(R):5'- TTTTGGTCCAGAGCCAACCAG -3'
Posted On2019-06-26