Incidental Mutation 'R7198:Pcdha4'
ID560116
Institutional Source Beutler Lab
Gene Symbol Pcdha4
Ensembl Gene ENSMUSG00000104252
Gene Nameprotocadherin alpha 4
SynonymsCnr1, Crnr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R7198 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36952648-37187661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36953560 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 265 (N265K)
Ref Sequence ENSEMBL: ENSMUSP00000141408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115661
AA Change: N265K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458
AA Change: N265K

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192295
AA Change: N265K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252
AA Change: N265K

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192512
AA Change: N265K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252
AA Change: N265K

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a C T 11: 110,078,655 S365N probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b A G 2: 59,962,206 L526P probably benign Het
Bbs1 A T 19: 4,895,015 L376Q probably damaging Het
Bcl9 T A 3: 97,205,195 M1315L possibly damaging Het
Bcl9 T C 3: 97,208,867 Q837R probably damaging Het
Cct2 A G 10: 117,053,124 V490A probably benign Het
Cdh23 T C 10: 60,312,599 Y2663C possibly damaging Het
Chit1 A G 1: 134,150,491 K346E possibly damaging Het
Chl1 A G 6: 103,706,556 Y781C probably damaging Het
Col12a1 A C 9: 79,650,032 L1938R possibly damaging Het
Cpxm2 T A 7: 132,080,084 N239Y probably damaging Het
Cyp3a41b A G 5: 145,582,520 Y54H probably benign Het
Dclk1 A C 3: 55,477,875 D369A possibly damaging Het
Dpy19l3 T C 7: 35,749,765 N71S possibly damaging Het
Fer T A 17: 63,921,688 V186E possibly damaging Het
Gm11042 T A 12: 74,315,114 H39L unknown Het
Gm11639 T A 11: 104,751,885 N1111K probably benign Het
Gm14325 A G 2: 177,832,005 I428T probably benign Het
Gm47995 A G 1: 151,198,653 E69G possibly damaging Het
Gm6176 T A 7: 22,051,171 I112F probably damaging Het
Hivep2 T A 10: 14,129,966 D769E probably benign Het
Hsdl1 C T 8: 119,567,868 V40I probably benign Het
Ipmk A G 10: 71,348,052 H34R probably damaging Het
Kcnd3 T C 3: 105,459,540 L242P probably damaging Het
Kdm4d T C 9: 14,464,020 M181V probably damaging Het
Lats2 A T 14: 57,697,125 I716N probably damaging Het
Liph T C 16: 21,966,022 Y305C probably damaging Het
Ltbp1 T C 17: 75,226,967 V150A possibly damaging Het
Ly6d A T 15: 74,762,535 S69T probably benign Het
Meltf A G 16: 31,883,799 R115G possibly damaging Het
Msgn1 G T 12: 11,208,901 D16E probably benign Het
Mthfd2l T A 5: 90,946,846 I58K probably damaging Het
Mup18 G C 4: 61,673,336 probably null Het
Nek10 T A 14: 14,850,947 W331R probably damaging Het
Nphp3 A G 9: 104,004,775 Y148C probably damaging Het
Olfr1256 T C 2: 89,835,732 Y71C probably damaging Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr820 T A 10: 130,017,891 C177S probably damaging Het
Oscp1 A G 4: 126,086,666 T325A possibly damaging Het
Pigq C T 17: 25,934,225 V331I probably benign Het
Plekhg4 A G 8: 105,378,697 E598G probably damaging Het
Pou6f2 G A 13: 18,129,163 T120M probably damaging Het
Psg27 T A 7: 18,561,801 T240S probably damaging Het
Samd12 T A 15: 53,860,253 I15F probably damaging Het
Scaf4 A T 16: 90,252,430 D256E unknown Het
Scaf8 T A 17: 3,163,098 M154K unknown Het
Slc27a1 T C 8: 71,579,427 V64A possibly damaging Het
Smc5 G A 19: 23,259,700 R256* probably null Het
Snx31 A G 15: 36,555,310 F31L probably benign Het
Spag17 T C 3: 100,095,572 S1871P probably benign Het
Tdpoz4 T G 3: 93,797,355 S320A probably benign Het
Tmprss11c A T 5: 86,231,832 C406S probably damaging Het
Tnip1 G A 11: 54,917,804 A519V probably benign Het
Tssc4 T A 7: 143,070,987 probably null Het
Uba3 A T 6: 97,205,551 M1K probably null Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Wdr78 A G 4: 103,062,413 V498A probably damaging Het
Wnt11 T C 7: 98,847,381 M176T possibly damaging Het
Wrn C T 8: 33,324,318 G366D probably benign Het
Xylt1 T A 7: 117,656,584 I793N probably damaging Het
Zfp677 T G 17: 21,398,417 C579G probably damaging Het
Zscan4-ps1 T A 7: 11,065,699 K421M probably damaging Het
Other mutations in Pcdha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2570:Pcdha4 UTSW 18 36953612 missense probably benign 0.00
R3114:Pcdha4 UTSW 18 36953550 missense probably benign 0.02
R3115:Pcdha4 UTSW 18 36953550 missense probably benign 0.02
R4154:Pcdha4 UTSW 18 36953586 splice site probably null
R4381:Pcdha4 UTSW 18 36952875 missense probably damaging 1.00
R4389:Pcdha4 UTSW 18 36954789 missense probably benign
R4493:Pcdha4 UTSW 18 36954591 missense possibly damaging 0.80
R4801:Pcdha4 UTSW 18 36953955 nonsense probably null
R4802:Pcdha4 UTSW 18 36953955 nonsense probably null
R4827:Pcdha4 UTSW 18 36953198 missense probably damaging 1.00
R4928:Pcdha4 UTSW 18 36954816 missense probably benign 0.01
R5001:Pcdha4 UTSW 18 36954948 missense probably benign
R5330:Pcdha4 UTSW 18 36954702 missense probably benign 0.01
R5331:Pcdha4 UTSW 18 36954702 missense probably benign 0.01
R5540:Pcdha4 UTSW 18 36954837 missense probably benign 0.01
R5587:Pcdha4 UTSW 18 36954822 missense probably benign
R5931:Pcdha4 UTSW 18 36954755 missense probably damaging 1.00
R6249:Pcdha4 UTSW 18 36953676 missense probably damaging 0.99
R6427:Pcdha4 UTSW 18 36953733 missense probably benign 0.00
R6612:Pcdha4 UTSW 18 36954978 missense probably benign 0.00
R6616:Pcdha4 UTSW 18 36953900 missense probably benign
R7030:Pcdha4 UTSW 18 36954027 missense probably damaging 1.00
R7411:Pcdha4 UTSW 18 36953058 missense probably benign 0.01
R7491:Pcdha4 UTSW 18 36954636 missense probably damaging 1.00
R7513:Pcdha4 UTSW 18 36953339 missense probably damaging 1.00
R7544:Pcdha4 UTSW 18 36953723 missense probably benign 0.05
R7735:Pcdha4 UTSW 18 36952908 missense probably damaging 1.00
R7753:Pcdha4 UTSW 18 36953301 missense possibly damaging 0.49
R8104:Pcdha4 UTSW 18 36954053 missense probably damaging 1.00
R8239:Pcdha4 UTSW 18 36953075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAATCTTTAGACCGGGAG -3'
(R):5'- CTTTACAGTGCCCAGAGAGTG -3'

Sequencing Primer
(F):5'- GGAAACTCCAGAGATAATTTTAGTGC -3'
(R):5'- GGAAGTTGTCCCTTGTCAATTC -3'
Posted On2019-06-26