Incidental Mutation 'R0592:Bbs7'
ID56012
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
Synonyms8430406N16Rik
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0592 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36610297 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 53 (V53D)
Ref Sequence ENSEMBL: ENSMUSP00000118961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156] [ENSMUST00000142333]
Predicted Effect probably benign
Transcript: ENSMUST00000040148
AA Change: V75D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: V75D

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108155
AA Change: V75D

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325
AA Change: V75D

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108156
AA Change: V75D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: V75D

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129671
Predicted Effect probably benign
Transcript: ENSMUST00000142333
AA Change: V53D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118961
Gene: ENSMUSG00000037325
AA Change: V53D

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36602873 missense probably damaging 1.00
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0720:Bbs7 UTSW 3 36592423 missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 unclassified probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1336:Bbs7 UTSW 3 36604444 missense probably benign
R1401:Bbs7 UTSW 3 36573557 missense probably benign 0.09
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36599373 missense probably benign
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R6912:Bbs7 UTSW 3 36605704 missense probably benign 0.00
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
R7456:Bbs7 UTSW 3 36594378 missense probably damaging 0.99
R8013:Bbs7 UTSW 3 36594387 missense not run
R8014:Bbs7 UTSW 3 36594387 missense not run
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Z1177:Bbs7 UTSW 3 36602920 missense not run
Predicted Primers PCR Primer
(F):5'- TGCCTGTAGCCAAATTTCTTTTCCAGA -3'
(R):5'- GGCGGCAGCTTTTCCAAAAGAC -3'

Sequencing Primer
(F):5'- GCCAAATTTCTTTTCCAGAAAAACC -3'
(R):5'- AGACAGATGCGCTACTTGCTG -3'
Posted On2013-07-11