Incidental Mutation 'R7199:Kcnh1'
ID560126
Institutional Source Beutler Lab
Gene Symbol Kcnh1
Ensembl Gene ENSMUSG00000058248
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 1
SynonymsKv10.1, Eag1, ether a go-go
MMRRC Submission
Accession Numbers

Genbank: NM_010600, NM_001038607; MGI: 1341721

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7199 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location192190774-192510159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 192337605 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 413 (I413N)
Ref Sequence ENSEMBL: ENSMUSP00000077563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844]
PDB Structure
Cyclic nucleotide binding-homology domain from mouse EAG1 potassium channel [X-RAY DIFFRACTION]
Crystal structure of PAS domain from the mouse EAG1 potassium channel [X-RAY DIFFRACTION]
Structure of the eag domain-CNBHD complex of the mouse EAG1 channel [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000078470
AA Change: I413N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: I413N

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
Pfam:Ion_trans 217 510 2.2e-40 PFAM
Pfam:Ion_trans_2 422 504 7e-14 PFAM
cNMP 581 699 2.2e-21 SMART
low complexity region 714 726 N/A INTRINSIC
coiled coil region 928 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110844
AA Change: I386N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248
AA Change: I386N

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
transmembrane domain 219 241 N/A INTRINSIC
Pfam:Ion_trans 252 471 3.4e-27 PFAM
Pfam:Ion_trans_2 395 477 3.7e-14 PFAM
cNMP 554 672 2.2e-21 SMART
low complexity region 687 699 N/A INTRINSIC
coiled coil region 901 931 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A G 16: 88,759,014 T39A probably damaging Het
5430419D17Rik G A 7: 131,235,912 W512* probably null Het
Abca3 G A 17: 24,377,707 G378D probably damaging Het
Abtb2 T C 2: 103,567,220 V165A possibly damaging Het
Ache A G 5: 137,290,242 E70G probably damaging Het
Adamtsl4 T C 3: 95,680,809 T623A probably benign Het
Ahdc1 G A 4: 133,064,624 V1059I probably benign Het
Ajuba G A 14: 54,573,458 Q357* probably null Het
Ano7 A T 1: 93,402,978 D54V Het
Apob A T 12: 8,005,072 D1357V probably damaging Het
Atad2b T A 12: 5,017,992 Y997N probably damaging Het
Bhlhe22 C A 3: 18,055,842 T352K probably damaging Het
Bsn T C 9: 108,115,334 E1073G probably damaging Het
Bzw2 G A 12: 36,130,055 R58* probably null Het
C7 G T 15: 4,994,243 S694R probably benign Het
Cbr2 T A 11: 120,730,261 H170L probably benign Het
Ckap2l T C 2: 129,285,055 N401S probably benign Het
Cldn1 A G 16: 26,371,596 F11L probably benign Het
Cmtr1 A G 17: 29,676,200 T118A probably benign Het
Cog6 T C 3: 52,983,189 E610G probably benign Het
Col3a1 G T 1: 45,332,141 A451S probably null Het
Cr1l T A 1: 195,117,570 R265S probably benign Het
Dapk1 T C 13: 60,754,210 I951T probably benign Het
Dnah9 T C 11: 66,118,944 N706D probably benign Het
Dpysl5 A T 5: 30,783,195 T239S probably benign Het
Ect2l T A 10: 18,129,146 Y913F probably benign Het
Elf5 C A 2: 103,439,296 A74D possibly damaging Het
Erap1 T C 13: 74,666,139 V399A probably benign Het
Ercc4 A G 16: 13,147,793 D763G probably damaging Het
Fam222b T A 11: 78,154,857 C415S possibly damaging Het
Fat4 A C 3: 38,977,362 N2432T probably damaging Het
Fbn2 G T 18: 58,053,761 C1689* probably null Het
Frrs1l T A 4: 56,972,282 T140S probably damaging Het
Gm14025 A G 2: 129,038,318 S563P Het
Gm5141 A T 13: 62,777,063 H10Q possibly damaging Het
Inafm1 A T 7: 16,273,154 L46Q probably damaging Het
Irak2 T C 6: 113,673,084 L260P probably damaging Het
Kat2b T C 17: 53,670,678 L751P probably damaging Het
Kirrel T C 3: 87,083,388 D709G probably benign Het
Lama4 T C 10: 39,080,540 V1153A possibly damaging Het
Lipg A T 18: 74,955,584 F98L probably benign Het
Lman1 T C 18: 65,994,865 E236G probably damaging Het
Lrp1 T A 10: 127,573,456 D1598V probably damaging Het
Lrrc71 T A 3: 87,743,077 N230Y probably damaging Het
Maneal T C 4: 124,857,190 S258G possibly damaging Het
March10 T A 11: 105,390,706 E251V probably damaging Het
Mb21d1 C A 9: 78,433,033 K472N probably benign Het
Mpdz A G 4: 81,297,333 I1484T probably damaging Het
Mtcl1 T A 17: 66,340,539 N1882I probably benign Het
Neb G A 2: 52,220,200 A212V probably benign Het
Obscn G A 11: 59,012,846 S7434L probably benign Het
Olfr1297 T C 2: 111,621,193 M294V probably benign Het
Olfr340 A T 2: 36,452,860 I92F probably damaging Het
Olfr51 T A 11: 51,007,396 C141* probably null Het
Olfr761 A C 17: 37,952,157 I289S probably damaging Het
Olfr971 A G 9: 39,839,457 M8V probably benign Het
Orc6 T C 8: 85,302,961 probably null Het
Otogl T G 10: 107,874,533 E565A possibly damaging Het
Papss1 A G 3: 131,585,138 Q214R probably benign Het
Pck2 G A 14: 55,548,712 V653M probably benign Het
Plxna4 G A 6: 32,215,178 Q826* probably null Het
Pms1 T A 1: 53,256,730 T161S probably benign Het
Prkar2a C A 9: 108,740,470 N242K probably damaging Het
Prss1 T A 6: 41,462,756 I141N probably damaging Het
Puf60 A G 15: 76,071,868 V235A probably damaging Het
Rapgef6 T A 11: 54,546,426 F65Y probably benign Het
Rasgef1b T C 5: 99,300,039 E104G unknown Het
Rcn3 T C 7: 45,084,909 Y225C probably damaging Het
Rhot1 G C 11: 80,246,734 W354S probably damaging Het
Rp1 T C 1: 4,347,290 S1200G possibly damaging Het
Scaper T A 9: 55,838,176 K603* probably null Het
Selenbp1 G A 3: 94,944,434 V429I possibly damaging Het
Setd5 T G 6: 113,121,138 S713A probably benign Het
Shank1 T C 7: 44,353,140 Y1428H possibly damaging Het
Slc11a1 G T 1: 74,383,671 W361L possibly damaging Het
Spta1 A T 1: 174,223,271 D1772V possibly damaging Het
St8sia6 T C 2: 13,656,910 H370R probably damaging Het
Stkld1 A T 2: 26,952,714 D566V probably damaging Het
Tango6 T C 8: 106,689,159 V204A probably benign Het
Tdrd5 G A 1: 156,301,723 A139V probably damaging Het
Tenm2 A T 11: 36,171,436 V534E probably damaging Het
Tfip11 A T 5: 112,331,178 Q204L probably benign Het
Tlr4 A T 4: 66,841,193 Q741L probably damaging Het
Tmem18 A G 12: 30,588,655 M111V probably benign Het
Togaram1 A G 12: 64,995,518 N1167S probably benign Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Trbj2-3 T C 6: 41,543,242 F7S probably damaging Het
Vmn1r212 T A 13: 22,883,561 M201L probably benign Het
Xaf1 C A 11: 72,303,375 C27* probably null Het
Zeb1 T C 18: 5,767,703 V738A probably benign Het
Zfp524 A T 7: 5,017,884 H137L probably damaging Het
Zfyve19 A T 2: 119,216,637 H367L probably damaging Het
Zim1 G A 7: 6,677,873 Q264* probably null Het
Other mutations in Kcnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Kcnh1 APN 1 192418882 missense probably damaging 0.99
IGL01675:Kcnh1 APN 1 192337593 missense probably benign 0.09
IGL01726:Kcnh1 APN 1 192505856 missense possibly damaging 0.47
IGL02006:Kcnh1 APN 1 192191015 missense possibly damaging 0.75
IGL02428:Kcnh1 APN 1 192337543 nonsense probably null
IGL02447:Kcnh1 APN 1 192224916 missense possibly damaging 0.61
IGL02512:Kcnh1 APN 1 192505381 missense possibly damaging 0.64
IGL02748:Kcnh1 APN 1 192221420 missense probably damaging 1.00
IGL02879:Kcnh1 APN 1 192276915 missense probably damaging 1.00
IGL02926:Kcnh1 APN 1 192276900 missense probably damaging 1.00
IGL03058:Kcnh1 APN 1 192434891 missense probably damaging 1.00
IGL03078:Kcnh1 APN 1 192434800 missense probably damaging 1.00
IGL03148:Kcnh1 APN 1 192276999 missense probably damaging 0.99
3-1:Kcnh1 UTSW 1 192337687 nonsense probably null
PIT4449001:Kcnh1 UTSW 1 192418684 missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 192276804 nonsense probably null
R0226:Kcnh1 UTSW 1 192276805 missense probably damaging 1.00
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0422:Kcnh1 UTSW 1 192337580 missense probably benign
R0510:Kcnh1 UTSW 1 192418941 splice site probably benign
R0612:Kcnh1 UTSW 1 192277053 missense probably damaging 1.00
R0667:Kcnh1 UTSW 1 192506038 missense probably benign 0.00
R0838:Kcnh1 UTSW 1 192413206 missense probably damaging 0.99
R1303:Kcnh1 UTSW 1 192276702 missense probably damaging 1.00
R1389:Kcnh1 UTSW 1 192505763 missense probably benign 0.00
R1826:Kcnh1 UTSW 1 192413068 missense possibly damaging 0.64
R1997:Kcnh1 UTSW 1 192276935 missense probably damaging 0.99
R2254:Kcnh1 UTSW 1 192505414 intron probably null
R2274:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R2275:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R3029:Kcnh1 UTSW 1 192506060 missense probably benign 0.00
R3427:Kcnh1 UTSW 1 192241930 missense probably benign 0.06
R3552:Kcnh1 UTSW 1 192238766 missense probably damaging 1.00
R3718:Kcnh1 UTSW 1 192238799 missense probably damaging 1.00
R3760:Kcnh1 UTSW 1 192506024 missense probably damaging 1.00
R4009:Kcnh1 UTSW 1 192277140 missense probably benign
R4027:Kcnh1 UTSW 1 192276699 missense probably benign 0.05
R4453:Kcnh1 UTSW 1 192505517 missense probably damaging 0.97
R4717:Kcnh1 UTSW 1 192276717 missense probably damaging 0.99
R5014:Kcnh1 UTSW 1 192277080 missense probably damaging 0.99
R5040:Kcnh1 UTSW 1 192505475 missense probably benign 0.00
R5110:Kcnh1 UTSW 1 192337747 missense possibly damaging 0.95
R5190:Kcnh1 UTSW 1 192505528 missense probably benign 0.00
R5244:Kcnh1 UTSW 1 192224876 missense probably benign 0.23
R5383:Kcnh1 UTSW 1 192505691 missense probably benign 0.03
R5926:Kcnh1 UTSW 1 192413077 missense probably benign 0.01
R6182:Kcnh1 UTSW 1 192191053 missense probably damaging 0.97
R6516:Kcnh1 UTSW 1 192418781 missense possibly damaging 0.50
R6567:Kcnh1 UTSW 1 192277104 missense probably benign
R6655:Kcnh1 UTSW 1 192413083 missense possibly damaging 0.89
R6715:Kcnh1 UTSW 1 192337641 missense probably benign 0.00
R6823:Kcnh1 UTSW 1 192505289 makesense probably null
R6972:Kcnh1 UTSW 1 192276836 missense probably damaging 1.00
R7219:Kcnh1 UTSW 1 192505637 missense probably benign
R7749:Kcnh1 UTSW 1 192277139 missense probably benign
R7799:Kcnh1 UTSW 1 192434875 missense probably damaging 0.96
R7862:Kcnh1 UTSW 1 192190859 start gained probably benign
R7945:Kcnh1 UTSW 1 192190859 start gained probably benign
R8068:Kcnh1 UTSW 1 192241942 missense probably benign 0.00
Z1176:Kcnh1 UTSW 1 192418737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTCTCTGAAAGTTGTGCGG -3'
(R):5'- ATGATGGCCACTGCGAAGATC -3'

Sequencing Primer
(F):5'- AAAGTTGTGCGGCTGCTCC -3'
(R):5'- ACTGCGAAGATCTTCTCGATG -3'
Posted On2019-06-26