Incidental Mutation 'R0592:Bglap'
ID56013
Institutional Source Beutler Lab
Gene Symbol Bglap
Ensembl Gene ENSMUSG00000074483
Gene Namebone gamma carboxyglutamate protein
SynonymsBglap, Bglap1, bone Gla protein, mOC-A, OC, OG1, osteocalcin
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R0592 (G1)
Quality Score198
Status Validated
Chromosome3
Chromosomal Location88383501-88384464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88383655 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 90 (I90F)
Ref Sequence ENSEMBL: ENSMUSP00000075425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076048] [ENSMUST00000098956]
Predicted Effect probably benign
Transcript: ENSMUST00000076048
AA Change: I90F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000075425
Gene: ENSMUSG00000074483
AA Change: I90F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.22e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098956
SMART Domains Protein: ENSMUSP00000096555
Gene: ENSMUSG00000074486

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.22e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107540
SMART Domains Protein: ENSMUSP00000103164
Gene: ENSMUSG00000078691

DomainStartEndE-ValueType
Pfam:HlyIII 5 127 3.4e-21 PFAM
transmembrane domain 148 170 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128732
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes one of the most abundant non-collagenous proteins in bone tissue that is localized to the mineralized matrix of bone. The encoded preproprotein undergoes proteolytic processing and post-translational gamma carboxylation to generate a mature, calcium-binding protein. Mice lacking the encoded protein develop abnormalities of bone remodelling. This gene is located adjacent to two other osteocalcin-related genes on chromosome 3. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of both Bglap1 and Bglap2 exhibit decreased circulating insulin, impaired glucose tolerance, increased adipose tissue, increased bone density, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Bglap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Bglap APN 3 88384350 critical splice donor site probably null
IGL02631:Bglap APN 3 88383680 nonsense probably null
IGL02738:Bglap APN 3 88384408 missense unknown
IGL03394:Bglap APN 3 88384005 missense probably benign 0.04
R1945:Bglap UTSW 3 88383664 missense probably damaging 1.00
R4067:Bglap UTSW 3 88384437 unclassified probably benign
R4795:Bglap UTSW 3 88384405 missense unknown
R4796:Bglap UTSW 3 88384405 missense unknown
R7744:Bglap UTSW 3 88383651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAGTGTGAAGCCTTCCCCGAC -3'
(R):5'- AGCCCTTAGCCTTCCATAGTGGTAG -3'

Sequencing Primer
(F):5'- CCACGATGGACAGACTCG -3'
(R):5'- TAGACGTGCAGGTCAATCC -3'
Posted On2013-07-11