Incidental Mutation 'R7199:Ahdc1'
ID560151
Institutional Source Beutler Lab
Gene Symbol Ahdc1
Ensembl Gene ENSMUSG00000037692
Gene NameAT hook, DNA binding motif, containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R7199 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location133011260-133078110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 133064624 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1059 (V1059I)
Ref Sequence ENSEMBL: ENSMUSP00000047113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044521] [ENSMUST00000105914] [ENSMUST00000105915] [ENSMUST00000105916]
Predicted Effect probably benign
Transcript: ENSMUST00000044521
AA Change: V1059I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047113
Gene: ENSMUSG00000037692
AA Change: V1059I

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105914
AA Change: V1059I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101534
Gene: ENSMUSG00000037692
AA Change: V1059I

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
Pfam:DUF4683 559 639 6.4e-15 PFAM
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105915
AA Change: V1059I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101535
Gene: ENSMUSG00000037692
AA Change: V1059I

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105916
AA Change: V1059I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101536
Gene: ENSMUSG00000037692
AA Change: V1059I

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two AT-hooks, which likely function in DNA binding. Mutations in this gene were found in individuals with Xia-Gibbs syndrome. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A G 16: 88,759,014 T39A probably damaging Het
5430419D17Rik G A 7: 131,235,912 W512* probably null Het
Abca3 G A 17: 24,377,707 G378D probably damaging Het
Abtb2 T C 2: 103,567,220 V165A possibly damaging Het
Ache A G 5: 137,290,242 E70G probably damaging Het
Adamtsl4 T C 3: 95,680,809 T623A probably benign Het
Ajuba G A 14: 54,573,458 Q357* probably null Het
Ano7 A T 1: 93,402,978 D54V Het
Apob A T 12: 8,005,072 D1357V probably damaging Het
Atad2b T A 12: 5,017,992 Y997N probably damaging Het
Bhlhe22 C A 3: 18,055,842 T352K probably damaging Het
Bsn T C 9: 108,115,334 E1073G probably damaging Het
Bzw2 G A 12: 36,130,055 R58* probably null Het
C7 G T 15: 4,994,243 S694R probably benign Het
Cbr2 T A 11: 120,730,261 H170L probably benign Het
Ckap2l T C 2: 129,285,055 N401S probably benign Het
Cldn1 A G 16: 26,371,596 F11L probably benign Het
Cmtr1 A G 17: 29,676,200 T118A probably benign Het
Cog6 T C 3: 52,983,189 E610G probably benign Het
Col3a1 G T 1: 45,332,141 A451S probably null Het
Cr1l T A 1: 195,117,570 R265S probably benign Het
Dapk1 T C 13: 60,754,210 I951T probably benign Het
Dnah9 T C 11: 66,118,944 N706D probably benign Het
Dpysl5 A T 5: 30,783,195 T239S probably benign Het
Ect2l T A 10: 18,129,146 Y913F probably benign Het
Elf5 C A 2: 103,439,296 A74D possibly damaging Het
Erap1 T C 13: 74,666,139 V399A probably benign Het
Ercc4 A G 16: 13,147,793 D763G probably damaging Het
Fam222b T A 11: 78,154,857 C415S possibly damaging Het
Fat4 A C 3: 38,977,362 N2432T probably damaging Het
Fbn2 G T 18: 58,053,761 C1689* probably null Het
Frrs1l T A 4: 56,972,282 T140S probably damaging Het
Gm14025 A G 2: 129,038,318 S563P Het
Gm5141 A T 13: 62,777,063 H10Q possibly damaging Het
Inafm1 A T 7: 16,273,154 L46Q probably damaging Het
Irak2 T C 6: 113,673,084 L260P probably damaging Het
Kat2b T C 17: 53,670,678 L751P probably damaging Het
Kcnh1 T A 1: 192,337,605 I413N probably benign Het
Kirrel T C 3: 87,083,388 D709G probably benign Het
Lama4 T C 10: 39,080,540 V1153A possibly damaging Het
Lipg A T 18: 74,955,584 F98L probably benign Het
Lman1 T C 18: 65,994,865 E236G probably damaging Het
Lrp1 T A 10: 127,573,456 D1598V probably damaging Het
Lrrc71 T A 3: 87,743,077 N230Y probably damaging Het
Maneal T C 4: 124,857,190 S258G possibly damaging Het
March10 T A 11: 105,390,706 E251V probably damaging Het
Mb21d1 C A 9: 78,433,033 K472N probably benign Het
Mpdz A G 4: 81,297,333 I1484T probably damaging Het
Mtcl1 T A 17: 66,340,539 N1882I probably benign Het
Neb G A 2: 52,220,200 A212V probably benign Het
Obscn G A 11: 59,012,846 S7434L probably benign Het
Olfr1297 T C 2: 111,621,193 M294V probably benign Het
Olfr340 A T 2: 36,452,860 I92F probably damaging Het
Olfr51 T A 11: 51,007,396 C141* probably null Het
Olfr761 A C 17: 37,952,157 I289S probably damaging Het
Olfr971 A G 9: 39,839,457 M8V probably benign Het
Orc6 T C 8: 85,302,961 probably null Het
Otogl T G 10: 107,874,533 E565A possibly damaging Het
Papss1 A G 3: 131,585,138 Q214R probably benign Het
Pck2 G A 14: 55,548,712 V653M probably benign Het
Plxna4 G A 6: 32,215,178 Q826* probably null Het
Pms1 T A 1: 53,256,730 T161S probably benign Het
Prkar2a C A 9: 108,740,470 N242K probably damaging Het
Prss1 T A 6: 41,462,756 I141N probably damaging Het
Puf60 A G 15: 76,071,868 V235A probably damaging Het
Rapgef6 T A 11: 54,546,426 F65Y probably benign Het
Rasgef1b T C 5: 99,300,039 E104G unknown Het
Rcn3 T C 7: 45,084,909 Y225C probably damaging Het
Rhot1 G C 11: 80,246,734 W354S probably damaging Het
Rp1 T C 1: 4,347,290 S1200G possibly damaging Het
Scaper T A 9: 55,838,176 K603* probably null Het
Selenbp1 G A 3: 94,944,434 V429I possibly damaging Het
Setd5 T G 6: 113,121,138 S713A probably benign Het
Shank1 T C 7: 44,353,140 Y1428H possibly damaging Het
Slc11a1 G T 1: 74,383,671 W361L possibly damaging Het
Spta1 A T 1: 174,223,271 D1772V possibly damaging Het
St8sia6 T C 2: 13,656,910 H370R probably damaging Het
Stkld1 A T 2: 26,952,714 D566V probably damaging Het
Tango6 T C 8: 106,689,159 V204A probably benign Het
Tdrd5 G A 1: 156,301,723 A139V probably damaging Het
Tenm2 A T 11: 36,171,436 V534E probably damaging Het
Tfip11 A T 5: 112,331,178 Q204L probably benign Het
Tlr4 A T 4: 66,841,193 Q741L probably damaging Het
Tmem18 A G 12: 30,588,655 M111V probably benign Het
Togaram1 A G 12: 64,995,518 N1167S probably benign Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Trbj2-3 T C 6: 41,543,242 F7S probably damaging Het
Vmn1r212 T A 13: 22,883,561 M201L probably benign Het
Xaf1 C A 11: 72,303,375 C27* probably null Het
Zeb1 T C 18: 5,767,703 V738A probably benign Het
Zfp524 A T 7: 5,017,884 H137L probably damaging Het
Zfyve19 A T 2: 119,216,637 H367L probably damaging Het
Zim1 G A 7: 6,677,873 Q264* probably null Het
Other mutations in Ahdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Ahdc1 APN 4 133063062 missense probably benign 0.33
IGL02293:Ahdc1 APN 4 133065618 missense possibly damaging 0.85
IGL02338:Ahdc1 APN 4 133062549 missense possibly damaging 0.73
IGL02828:Ahdc1 APN 4 133062921 missense possibly damaging 0.96
IGL02859:Ahdc1 APN 4 133062692 missense possibly damaging 0.53
IGL02859:Ahdc1 APN 4 133062693 missense probably damaging 0.99
IGL02901:Ahdc1 APN 4 133064934 missense possibly damaging 0.85
IGL03323:Ahdc1 APN 4 133065428 missense probably benign
FR4304:Ahdc1 UTSW 4 133062759 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062757 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062760 small insertion probably benign
FR4737:Ahdc1 UTSW 4 133062759 small insertion probably benign
R0325:Ahdc1 UTSW 4 133062719 missense unknown
R0550:Ahdc1 UTSW 4 133063037 missense probably benign 0.33
R0681:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0683:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0731:Ahdc1 UTSW 4 133062951 missense possibly damaging 0.86
R0751:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1137:Ahdc1 UTSW 4 133062113 missense possibly damaging 0.68
R1184:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1331:Ahdc1 UTSW 4 133063691 missense probably benign 0.18
R1599:Ahdc1 UTSW 4 133064936 missense possibly damaging 0.91
R2202:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2205:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2261:Ahdc1 UTSW 4 133063163 missense unknown
R2262:Ahdc1 UTSW 4 133063163 missense unknown
R3683:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3684:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3685:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3713:Ahdc1 UTSW 4 133065986 missense possibly damaging 0.85
R4027:Ahdc1 UTSW 4 133064165 missense possibly damaging 0.73
R4807:Ahdc1 UTSW 4 133064313 missense possibly damaging 0.86
R4987:Ahdc1 UTSW 4 133064320 missense possibly damaging 0.53
R5126:Ahdc1 UTSW 4 133063522 missense probably benign 0.18
R5276:Ahdc1 UTSW 4 133062798 missense possibly damaging 0.93
R5680:Ahdc1 UTSW 4 133065596 missense probably benign
R5997:Ahdc1 UTSW 4 133063895 missense probably benign 0.05
R6050:Ahdc1 UTSW 4 133065891 missense possibly damaging 0.85
R6271:Ahdc1 UTSW 4 133064724 missense possibly damaging 0.73
R6410:Ahdc1 UTSW 4 133062899 missense probably damaging 0.97
R6519:Ahdc1 UTSW 4 133064768 missense possibly damaging 0.86
R6970:Ahdc1 UTSW 4 133062345 missense possibly damaging 0.96
R7202:Ahdc1 UTSW 4 133061887 nonsense probably null
R7576:Ahdc1 UTSW 4 133065002 missense possibly damaging 0.91
R7614:Ahdc1 UTSW 4 133063514 missense probably benign 0.18
R7794:Ahdc1 UTSW 4 133063978 missense possibly damaging 0.70
R7875:Ahdc1 UTSW 4 133063850 missense possibly damaging 0.53
R7958:Ahdc1 UTSW 4 133063850 missense possibly damaging 0.53
R8016:Ahdc1 UTSW 4 133062915 missense possibly damaging 0.96
RF017:Ahdc1 UTSW 4 133062751 small insertion probably benign
RF020:Ahdc1 UTSW 4 133064277 missense possibly damaging 0.96
T0722:Ahdc1 UTSW 4 133062754 small insertion probably benign
T0975:Ahdc1 UTSW 4 133062754 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCCCTTTTCAGGCCAG -3'
(R):5'- CTGACTAAAGGCCTCTGAGG -3'

Sequencing Primer
(F):5'- AAGGACTGCAGCTTCGCCTATG -3'
(R):5'- TCTGAGGCCCAGTCCAG -3'
Posted On2019-06-26