Incidental Mutation 'R0592:Fhl3'
ID56017
Institutional Source Beutler Lab
Gene Symbol Fhl3
Ensembl Gene ENSMUSG00000032643
Gene Namefour and a half LIM domains 3
Synonyms
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R0592 (G1)
Quality Score126
Status Validated
Chromosome4
Chromosomal Location124700701-124708611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124705677 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 15 (Y15C)
Ref Sequence ENSEMBL: ENSMUSP00000101805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038684] [ENSMUST00000106199] [ENSMUST00000145942]
Predicted Effect probably benign
Transcript: ENSMUST00000038684
AA Change: Y15C

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040150
Gene: ENSMUSG00000032643
AA Change: Y15C

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 284 2.91e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106199
AA Change: Y15C

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101805
Gene: ENSMUSG00000032643
AA Change: Y15C

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 275 8.49e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145942
AA Change: Y15C

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121702
Gene: ENSMUSG00000032643
AA Change: Y15C

DomainStartEndE-ValueType
Blast:LIM 1 31 5e-6 BLAST
LIM 39 92 2.7e-11 SMART
Meta Mutation Damage Score 0.1045 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Fhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1118:Fhl3 UTSW 4 124705791 critical splice donor site probably null
R2402:Fhl3 UTSW 4 124705688 missense probably damaging 1.00
R2921:Fhl3 UTSW 4 124705670 missense probably damaging 1.00
R2923:Fhl3 UTSW 4 124705670 missense probably damaging 1.00
R4583:Fhl3 UTSW 4 124707549 missense probably benign 0.41
R5147:Fhl3 UTSW 4 124707931 missense probably benign 0.01
R5460:Fhl3 UTSW 4 124706003 missense probably damaging 1.00
R5932:Fhl3 UTSW 4 124705727 missense probably damaging 1.00
R6855:Fhl3 UTSW 4 124707522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAAGATTCGAGCATACATGGAGC -3'
(R):5'- TGGAAGTGGCGGTCCTCATAGAAC -3'

Sequencing Primer
(F):5'- CGAGCATACATGGAGCCTACTG -3'
(R):5'- GCGGTCCTCATAGAACAGTTCC -3'
Posted On2013-07-11