Mutagenetix > Incidental Mutations

Incidental Mutation 'R7199:Prkar2a'

560173

Institutional Source

Beutler Lab

Gene Symbol

Prkar2a

Ensembl Gene

ENSMUSG00000032601

Gene Name

protein kinase, cAMP dependent regulatory, type II alpha

Synonyms

1110061A24Rik, RII(alpha)

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7199 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108689314-108750436 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 108740470 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 242 (N242K)

Ref Sequence

ENSEMBL: ENSMUSP00000035220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035220] [ENSMUST00000195405]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035220
AA Change: N242K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035220
Gene: ENSMUSG00000032601
AA Change: N242K

Domain	Start	End	E-Value	Type
RIIa	8	45	7.15e-16	SMART
low complexity region	70	85	N/A	INTRINSIC
low complexity region	104	114	N/A	INTRINSIC
cNMP	137	257	2.27e-23	SMART
cNMP	259	384	2.02e-29	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000192068
AA Change: N141K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195405
AA Change: N242K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141869
Gene: ENSMUSG00000032601
AA Change: N242K

Domain	Start	End	E-Value	Type
RIIa	8	45	4.3e-18	SMART
low complexity region	70	85	N/A	INTRINSIC
low complexity region	104	114	N/A	INTRINSIC
cNMP	137	257	1.1e-25	SMART
cNMP	259	362	3.9e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and appear healthy. They have normal growth and no deficits in locomotor activity, muscle strength, or exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	A	G	16: 88,759,014	T39A	probably damaging	Het
5430419D17Rik	G	A	7: 131,235,912	W512*	probably null	Het
Abca3	G	A	17: 24,377,707	G378D	probably damaging	Het
Abtb2	T	C	2: 103,567,220	V165A	possibly damaging	Het
Ache	A	G	5: 137,290,242	E70G	probably damaging	Het
Adamtsl4	T	C	3: 95,680,809	T623A	probably benign	Het
Ahdc1	G	A	4: 133,064,624	V1059I	probably benign	Het
Ajuba	G	A	14: 54,573,458	Q357*	probably null	Het
Ano7	A	T	1: 93,402,978	D54V		Het
Apob	A	T	12: 8,005,072	D1357V	probably damaging	Het
Atad2b	T	A	12: 5,017,992	Y997N	probably damaging	Het
Bhlhe22	C	A	3: 18,055,842	T352K	probably damaging	Het
Bsn	T	C	9: 108,115,334	E1073G	probably damaging	Het
Bzw2	G	A	12: 36,130,055	R58*	probably null	Het
C7	G	T	15: 4,994,243	S694R	probably benign	Het
Cbr2	T	A	11: 120,730,261	H170L	probably benign	Het
Ckap2l	T	C	2: 129,285,055	N401S	probably benign	Het
Cldn1	A	G	16: 26,371,596	F11L	probably benign	Het
Cmtr1	A	G	17: 29,676,200	T118A	probably benign	Het
Cog6	T	C	3: 52,983,189	E610G	probably benign	Het
Col3a1	G	T	1: 45,332,141	A451S	probably null	Het
Cr1l	T	A	1: 195,117,570	R265S	probably benign	Het
Dapk1	T	C	13: 60,754,210	I951T	probably benign	Het
Dnah9	T	C	11: 66,118,944	N706D	probably benign	Het
Dpysl5	A	T	5: 30,783,195	T239S	probably benign	Het
Ect2l	T	A	10: 18,129,146	Y913F	probably benign	Het
Elf5	C	A	2: 103,439,296	A74D	possibly damaging	Het
Erap1	T	C	13: 74,666,139	V399A	probably benign	Het
Ercc4	A	G	16: 13,147,793	D763G	probably damaging	Het
Fam222b	T	A	11: 78,154,857	C415S	possibly damaging	Het
Fat4	A	C	3: 38,977,362	N2432T	probably damaging	Het
Fbn2	G	T	18: 58,053,761	C1689*	probably null	Het
Frrs1l	T	A	4: 56,972,282	T140S	probably damaging	Het
Gm14025	A	G	2: 129,038,318	S563P		Het
Gm5141	A	T	13: 62,777,063	H10Q	possibly damaging	Het
Inafm1	A	T	7: 16,273,154	L46Q	probably damaging	Het
Irak2	T	C	6: 113,673,084	L260P	probably damaging	Het
Kat2b	T	C	17: 53,670,678	L751P	probably damaging	Het
Kcnh1	T	A	1: 192,337,605	I413N	probably benign	Het
Kirrel	T	C	3: 87,083,388	D709G	probably benign	Het
Lama4	T	C	10: 39,080,540	V1153A	possibly damaging	Het
Lipg	A	T	18: 74,955,584	F98L	probably benign	Het
Lman1	T	C	18: 65,994,865	E236G	probably damaging	Het
Lrp1	T	A	10: 127,573,456	D1598V	probably damaging	Het
Lrrc71	T	A	3: 87,743,077	N230Y	probably damaging	Het
Maneal	T	C	4: 124,857,190	S258G	possibly damaging	Het
March10	T	A	11: 105,390,706	E251V	probably damaging	Het
Mb21d1	C	A	9: 78,433,033	K472N	probably benign	Het
Mpdz	A	G	4: 81,297,333	I1484T	probably damaging	Het
Mtcl1	T	A	17: 66,340,539	N1882I	probably benign	Het
Neb	G	A	2: 52,220,200	A212V	probably benign	Het
Obscn	G	A	11: 59,012,846	S7434L	probably benign	Het
Olfr1297	T	C	2: 111,621,193	M294V	probably benign	Het
Olfr340	A	T	2: 36,452,860	I92F	probably damaging	Het
Olfr51	T	A	11: 51,007,396	C141*	probably null	Het
Olfr761	A	C	17: 37,952,157	I289S	probably damaging	Het
Olfr971	A	G	9: 39,839,457	M8V	probably benign	Het
Orc6	T	C	8: 85,302,961		probably null	Het
Otogl	T	G	10: 107,874,533	E565A	possibly damaging	Het
Papss1	A	G	3: 131,585,138	Q214R	probably benign	Het
Pck2	G	A	14: 55,548,712	V653M	probably benign	Het
Plxna4	G	A	6: 32,215,178	Q826*	probably null	Het
Pms1	T	A	1: 53,256,730	T161S	probably benign	Het
Prss1	T	A	6: 41,462,756	I141N	probably damaging	Het
Puf60	A	G	15: 76,071,868	V235A	probably damaging	Het
Rapgef6	T	A	11: 54,546,426	F65Y	probably benign	Het
Rasgef1b	T	C	5: 99,300,039	E104G	unknown	Het
Rcn3	T	C	7: 45,084,909	Y225C	probably damaging	Het
Rhot1	G	C	11: 80,246,734	W354S	probably damaging	Het
Rp1	T	C	1: 4,347,290	S1200G	possibly damaging	Het
Scaper	T	A	9: 55,838,176	K603*	probably null	Het
Selenbp1	G	A	3: 94,944,434	V429I	possibly damaging	Het
Setd5	T	G	6: 113,121,138	S713A	probably benign	Het
Shank1	T	C	7: 44,353,140	Y1428H	possibly damaging	Het
Slc11a1	G	T	1: 74,383,671	W361L	possibly damaging	Het
Spta1	A	T	1: 174,223,271	D1772V	possibly damaging	Het
St8sia6	T	C	2: 13,656,910	H370R	probably damaging	Het
Stkld1	A	T	2: 26,952,714	D566V	probably damaging	Het
Tango6	T	C	8: 106,689,159	V204A	probably benign	Het
Tdrd5	G	A	1: 156,301,723	A139V	probably damaging	Het
Tenm2	A	T	11: 36,171,436	V534E	probably damaging	Het
Tfip11	A	T	5: 112,331,178	Q204L	probably benign	Het
Tlr4	A	T	4: 66,841,193	Q741L	probably damaging	Het
Tmem18	A	G	12: 30,588,655	M111V	probably benign	Het
Togaram1	A	G	12: 64,995,518	N1167S	probably benign	Het
Trappc3	C	T	4: 126,275,152	A145V	possibly damaging	Het
Trbj2-3	T	C	6: 41,543,242	F7S	probably damaging	Het
Vmn1r212	T	A	13: 22,883,561	M201L	probably benign	Het
Xaf1	C	A	11: 72,303,375	C27*	probably null	Het
Zeb1	T	C	18: 5,767,703	V738A	probably benign	Het
Zfp524	A	T	7: 5,017,884	H137L	probably damaging	Het
Zfyve19	A	T	2: 119,216,637	H367L	probably damaging	Het
Zim1	G	A	7: 6,677,873	Q264*	probably null	Het

Other mutations in Prkar2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02064:Prkar2a	APN	9	108733204	missense	possibly damaging	0.92
IGL02073:Prkar2a	APN	9	108733123	missense	probably damaging	0.99
IGL02117:Prkar2a	APN	9	108719261	missense	probably damaging	1.00
IGL02268:Prkar2a	APN	9	108746953	missense	probably benign	0.04
IGL02635:Prkar2a	APN	9	108728277	missense	probably damaging	0.99
IGL03006:Prkar2a	APN	9	108740441	missense	probably benign
PIT4486001:Prkar2a	UTSW	9	108733127	missense	probably damaging	1.00
R0335:Prkar2a	UTSW	9	108719258	missense	probably damaging	1.00
R0920:Prkar2a	UTSW	9	108719297	splice site	probably benign
R0943:Prkar2a	UTSW	9	108733276	splice site	probably benign
R1513:Prkar2a	UTSW	9	108728270	missense	possibly damaging	0.82
R2178:Prkar2a	UTSW	9	108740538	critical splice donor site	probably null
R3820:Prkar2a	UTSW	9	108746956	missense	probably damaging	1.00
R3842:Prkar2a	UTSW	9	108728268	missense	probably damaging	1.00
R4807:Prkar2a	UTSW	9	108740385	intron	probably benign
R4886:Prkar2a	UTSW	9	108745624	critical splice donor site	probably null
R5051:Prkar2a	UTSW	9	108745491	missense	probably benign	0.00
R5435:Prkar2a	UTSW	9	108740483	missense	probably damaging	1.00
R6979:Prkar2a	UTSW	9	108733143	missense	possibly damaging	0.76
R7121:Prkar2a	UTSW	9	108692622	missense	probably benign
R7819:Prkar2a	UTSW	9	108745545	missense	probably damaging	1.00
X0060:Prkar2a	UTSW	9	108745582	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCACTCACTGAACACAGC -3'
(R):5'- GCCTGACTGAATGTTATGGTTAC -3'

Sequencing Primer
(F):5'- ACAGTTTGGAAACTTCTGCTTAGAGG -3'
(R):5'- TGGTTACAACTAGGTTAGAACAGC -3'

Posted On

2019-06-26