Mutagenetix > Incidental Mutation

Incidental Mutation 'R7199:Dnah9'

560182

Institutional Source

Beutler Lab

Gene Symbol

Dnah9

Ensembl Gene

ENSMUSG00000056752

Gene Name

dynein, axonemal, heavy chain 9

Synonyms

D11Ertd686e, Dnahc9

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.346) question?

Stock #

R7199 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65831282-66168551 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66118944 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 706 (N706D)

Ref Sequence

ENSEMBL: ENSMUSP00000079494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080665] [ENSMUST00000108691]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000080665
AA Change: N706D

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: N706D

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	209	787	3.6e-164	PFAM
coiled coil region	788	820	N/A	INTRINSIC
low complexity region	1228	1240	N/A	INTRINSIC
Pfam:DHC_N2	1290	1699	1.4e-134	PFAM
AAA	1863	1999	4.9e-1	SMART
AAA	2141	2341	1.99e0	SMART
AAA	2468	2614	6.75e-1	SMART
Pfam:AAA_8	2786	3053	1.1e-165	PFAM
Pfam:MT	3065	3408	7.2e-208	PFAM
Pfam:AAA_9	3430	3652	3.2e-87	PFAM
Pfam:Dynein_heavy	3786	4482	1e-241	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108691

SMART Domains

Protein: ENSMUSP00000104331
Gene: ENSMUSG00000056752

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	10	457	2.3e-141	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	A	G	16: 88,759,014	T39A	probably damaging	Het
5430419D17Rik	G	A	7: 131,235,912	W512*	probably null	Het
Abca3	G	A	17: 24,377,707	G378D	probably damaging	Het
Abtb2	T	C	2: 103,567,220	V165A	possibly damaging	Het
Ache	A	G	5: 137,290,242	E70G	probably damaging	Het
Adamtsl4	T	C	3: 95,680,809	T623A	probably benign	Het
Ahdc1	G	A	4: 133,064,624	V1059I	probably benign	Het
Ajuba	G	A	14: 54,573,458	Q357*	probably null	Het
Ano7	A	T	1: 93,402,978	D54V		Het
Apob	A	T	12: 8,005,072	D1357V	probably damaging	Het
Atad2b	T	A	12: 5,017,992	Y997N	probably damaging	Het
Bhlhe22	C	A	3: 18,055,842	T352K	probably damaging	Het
Bsn	T	C	9: 108,115,334	E1073G	probably damaging	Het
Bzw2	G	A	12: 36,130,055	R58*	probably null	Het
C7	G	T	15: 4,994,243	S694R	probably benign	Het
Cbr2	T	A	11: 120,730,261	H170L	probably benign	Het
Ckap2l	T	C	2: 129,285,055	N401S	probably benign	Het
Cldn1	A	G	16: 26,371,596	F11L	probably benign	Het
Cmtr1	A	G	17: 29,676,200	T118A	probably benign	Het
Cog6	T	C	3: 52,983,189	E610G	probably benign	Het
Col3a1	G	T	1: 45,332,141	A451S	probably null	Het
Cr1l	T	A	1: 195,117,570	R265S	probably benign	Het
Dapk1	T	C	13: 60,754,210	I951T	probably benign	Het
Dpysl5	A	T	5: 30,783,195	T239S	probably benign	Het
Ect2l	T	A	10: 18,129,146	Y913F	probably benign	Het
Elf5	C	A	2: 103,439,296	A74D	possibly damaging	Het
Erap1	T	C	13: 74,666,139	V399A	probably benign	Het
Ercc4	A	G	16: 13,147,793	D763G	probably damaging	Het
Fam222b	T	A	11: 78,154,857	C415S	possibly damaging	Het
Fat4	A	C	3: 38,977,362	N2432T	probably damaging	Het
Fbn2	G	T	18: 58,053,761	C1689*	probably null	Het
Frrs1l	T	A	4: 56,972,282	T140S	probably damaging	Het
Gm14025	A	G	2: 129,038,318	S563P		Het
Gm5141	A	T	13: 62,777,063	H10Q	possibly damaging	Het
Inafm1	A	T	7: 16,273,154	L46Q	probably damaging	Het
Irak2	T	C	6: 113,673,084	L260P	probably damaging	Het
Kat2b	T	C	17: 53,670,678	L751P	probably damaging	Het
Kcnh1	T	A	1: 192,337,605	I413N	probably benign	Het
Kirrel	T	C	3: 87,083,388	D709G	probably benign	Het
Lama4	T	C	10: 39,080,540	V1153A	possibly damaging	Het
Lipg	A	T	18: 74,955,584	F98L	probably benign	Het
Lman1	T	C	18: 65,994,865	E236G	probably damaging	Het
Lrp1	T	A	10: 127,573,456	D1598V	probably damaging	Het
Lrrc71	T	A	3: 87,743,077	N230Y	probably damaging	Het
Maneal	T	C	4: 124,857,190	S258G	possibly damaging	Het
March10	T	A	11: 105,390,706	E251V	probably damaging	Het
Mb21d1	C	A	9: 78,433,033	K472N	probably benign	Het
Mpdz	A	G	4: 81,297,333	I1484T	probably damaging	Het
Mtcl1	T	A	17: 66,340,539	N1882I	probably benign	Het
Neb	G	A	2: 52,220,200	A212V	probably benign	Het
Obscn	G	A	11: 59,012,846	S7434L	probably benign	Het
Olfr1297	T	C	2: 111,621,193	M294V	probably benign	Het
Olfr340	A	T	2: 36,452,860	I92F	probably damaging	Het
Olfr51	T	A	11: 51,007,396	C141*	probably null	Het
Olfr761	A	C	17: 37,952,157	I289S	probably damaging	Het
Olfr971	A	G	9: 39,839,457	M8V	probably benign	Het
Orc6	T	C	8: 85,302,961		probably null	Het
Otogl	T	G	10: 107,874,533	E565A	possibly damaging	Het
Papss1	A	G	3: 131,585,138	Q214R	probably benign	Het
Pck2	G	A	14: 55,548,712	V653M	probably benign	Het
Plxna4	G	A	6: 32,215,178	Q826*	probably null	Het
Pms1	T	A	1: 53,256,730	T161S	probably benign	Het
Prkar2a	C	A	9: 108,740,470	N242K	probably damaging	Het
Prss1	T	A	6: 41,462,756	I141N	probably damaging	Het
Puf60	A	G	15: 76,071,868	V235A	probably damaging	Het
Rapgef6	T	A	11: 54,546,426	F65Y	probably benign	Het
Rasgef1b	T	C	5: 99,300,039	E104G	unknown	Het
Rcn3	T	C	7: 45,084,909	Y225C	probably damaging	Het
Rhot1	G	C	11: 80,246,734	W354S	probably damaging	Het
Rp1	T	C	1: 4,347,290	S1200G	possibly damaging	Het
Scaper	T	A	9: 55,838,176	K603*	probably null	Het
Selenbp1	G	A	3: 94,944,434	V429I	possibly damaging	Het
Setd5	T	G	6: 113,121,138	S713A	probably benign	Het
Shank1	T	C	7: 44,353,140	Y1428H	possibly damaging	Het
Slc11a1	G	T	1: 74,383,671	W361L	possibly damaging	Het
Spta1	A	T	1: 174,223,271	D1772V	possibly damaging	Het
St8sia6	T	C	2: 13,656,910	H370R	probably damaging	Het
Stkld1	A	T	2: 26,952,714	D566V	probably damaging	Het
Tango6	T	C	8: 106,689,159	V204A	probably benign	Het
Tdrd5	G	A	1: 156,301,723	A139V	probably damaging	Het
Tenm2	A	T	11: 36,171,436	V534E	probably damaging	Het
Tfip11	A	T	5: 112,331,178	Q204L	probably benign	Het
Tlr4	A	T	4: 66,841,193	Q741L	probably damaging	Het
Tmem18	A	G	12: 30,588,655	M111V	probably benign	Het
Togaram1	A	G	12: 64,995,518	N1167S	probably benign	Het
Trappc3	C	T	4: 126,275,152	A145V	possibly damaging	Het
Trbj2-3	T	C	6: 41,543,242	F7S	probably damaging	Het
Vmn1r212	T	A	13: 22,883,561	M201L	probably benign	Het
Xaf1	C	A	11: 72,303,375	C27*	probably null	Het
Zeb1	T	C	18: 5,767,703	V738A	probably benign	Het
Zfp524	A	T	7: 5,017,884	H137L	probably damaging	Het
Zfyve19	A	T	2: 119,216,637	H367L	probably damaging	Het
Zim1	G	A	7: 6,677,873	Q264*	probably null	Het

Other mutations in Dnah9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00696:Dnah9	APN	11	65841238	splice site	probably benign
IGL00805:Dnah9	APN	11	65881695	missense	probably benign	0.00
IGL00826:Dnah9	APN	11	65989942	missense	probably damaging	1.00
IGL01108:Dnah9	APN	11	65849980	missense	possibly damaging	0.93
IGL01152:Dnah9	APN	11	66072056	missense	probably damaging	1.00
IGL01353:Dnah9	APN	11	66080571	missense	probably damaging	1.00
IGL01364:Dnah9	APN	11	66155459	missense	probably damaging	1.00
IGL01479:Dnah9	APN	11	65955717	missense	probably benign	0.14
IGL01537:Dnah9	APN	11	65947680	missense	probably benign
IGL01565:Dnah9	APN	11	66033829	missense	possibly damaging	0.95
IGL01597:Dnah9	APN	11	66118830	missense	probably damaging	1.00
IGL01619:Dnah9	APN	11	65831615	nonsense	probably null
IGL01625:Dnah9	APN	11	66044645	missense	probably damaging	1.00
IGL01803:Dnah9	APN	11	66118829	missense	probably damaging	1.00
IGL01819:Dnah9	APN	11	66108126	missense	probably benign	0.33
IGL01896:Dnah9	APN	11	66130666	missense	possibly damaging	0.89
IGL01922:Dnah9	APN	11	66075034	splice site	probably benign
IGL01923:Dnah9	APN	11	66125235	splice site	probably benign
IGL02059:Dnah9	APN	11	66072958	missense	probably damaging	1.00
IGL02068:Dnah9	APN	11	66061045	missense	probably damaging	1.00
IGL02135:Dnah9	APN	11	66117492	missense	possibly damaging	0.63
IGL02146:Dnah9	APN	11	65927700	missense	probably damaging	1.00
IGL02264:Dnah9	APN	11	66080488	splice site	probably benign
IGL02325:Dnah9	APN	11	65834217	missense	probably damaging	1.00
IGL02426:Dnah9	APN	11	66125153	missense	probably benign
IGL02440:Dnah9	APN	11	65955246	missense	probably damaging	1.00
IGL02471:Dnah9	APN	11	65947618	nonsense	probably null
IGL02496:Dnah9	APN	11	66029363	missense	probably damaging	1.00
IGL02672:Dnah9	APN	11	65927601	missense	probably benign	0.02
IGL02718:Dnah9	APN	11	65886640	missense	probably damaging	0.99
IGL02832:Dnah9	APN	11	66040346	missense	probably damaging	1.00
IGL02851:Dnah9	APN	11	66037744	splice site	probably benign
IGL02859:Dnah9	APN	11	65881619	splice site	probably benign
IGL02864:Dnah9	APN	11	66061003	missense	probably damaging	1.00
IGL02954:Dnah9	APN	11	66118967	missense	probably damaging	1.00
IGL02987:Dnah9	APN	11	65855272	missense	probably damaging	0.98
IGL02987:Dnah9	APN	11	65841273	missense	probably benign	0.23
IGL03160:Dnah9	APN	11	66108054	missense	probably damaging	0.98
IGL03171:Dnah9	APN	11	65981241	missense	probably benign	0.13
IGL03180:Dnah9	APN	11	65886639	missense	probably damaging	0.99
IGL03388:Dnah9	APN	11	65947542	missense	probably damaging	1.00
anarchy	UTSW	11	65955248	missense	probably damaging	0.99
sacco	UTSW	11	66168079	missense	possibly damaging	0.82
Tweed	UTSW	11	66072072	missense	probably damaging	0.99
vanzetti	UTSW	11	65855372	nonsense	probably null
IGL02837:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
PIT4280001:Dnah9	UTSW	11	66005013	missense	probably benign	0.44
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0070:Dnah9	UTSW	11	66160040	missense	probably benign	0.10
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0180:Dnah9	UTSW	11	66147290	missense	probably damaging	1.00
R0195:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R0230:Dnah9	UTSW	11	65855315	missense	probably damaging	1.00
R0243:Dnah9	UTSW	11	65911852	missense	possibly damaging	0.91
R0279:Dnah9	UTSW	11	65911789	critical splice donor site	probably null
R0288:Dnah9	UTSW	11	66025134	critical splice donor site	probably null
R0309:Dnah9	UTSW	11	66026972	splice site	probably benign
R0356:Dnah9	UTSW	11	66130562	critical splice donor site	probably null
R0403:Dnah9	UTSW	11	66084789	missense	possibly damaging	0.90
R0413:Dnah9	UTSW	11	66108135	missense	probably damaging	1.00
R0448:Dnah9	UTSW	11	65918713	splice site	probably benign
R0496:Dnah9	UTSW	11	66075135	missense	probably null	1.00
R0557:Dnah9	UTSW	11	66084666	missense	probably damaging	1.00
R0584:Dnah9	UTSW	11	65990489	missense	probably damaging	1.00
R0598:Dnah9	UTSW	11	66118877	missense	probably benign	0.02
R0599:Dnah9	UTSW	11	65965689	missense	probably damaging	1.00
R0606:Dnah9	UTSW	11	65841333	missense	probably damaging	1.00
R0666:Dnah9	UTSW	11	66085458	missense	probably benign	0.01
R0715:Dnah9	UTSW	11	66081248	splice site	probably benign
R0726:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R0737:Dnah9	UTSW	11	66107898	missense	probably damaging	1.00
R0763:Dnah9	UTSW	11	66155530	missense	probably benign	0.30
R0792:Dnah9	UTSW	11	65896001	missense	possibly damaging	0.84
R0829:Dnah9	UTSW	11	66005176	missense	probably benign	0.00
R0973:Dnah9	UTSW	11	66005837	splice site	probably null
R0974:Dnah9	UTSW	11	66005837	splice site	probably null
R1055:Dnah9	UTSW	11	66160011	missense	probably damaging	1.00
R1081:Dnah9	UTSW	11	66084877	missense	probably damaging	0.99
R1184:Dnah9	UTSW	11	66084612	critical splice donor site	probably null
R1225:Dnah9	UTSW	11	65871060	missense	possibly damaging	0.94
R1304:Dnah9	UTSW	11	65927588	missense	probably damaging	0.98
R1417:Dnah9	UTSW	11	65955747	missense	probably damaging	0.96
R1439:Dnah9	UTSW	11	65874132	missense	probably benign	0.22
R1447:Dnah9	UTSW	11	66108482	missense	possibly damaging	0.65
R1450:Dnah9	UTSW	11	65927786	missense	probably damaging	1.00
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1486:Dnah9	UTSW	11	65834272	missense	probably damaging	1.00
R1519:Dnah9	UTSW	11	65881761	missense	probably damaging	0.96
R1570:Dnah9	UTSW	11	66112330	missense	probably benign
R1617:Dnah9	UTSW	11	65895921	missense	probably damaging	1.00
R1623:Dnah9	UTSW	11	66037637	missense	probably damaging	1.00
R1626:Dnah9	UTSW	11	66085267	missense	probably benign	0.05
R1671:Dnah9	UTSW	11	65927963	missense	probably damaging	0.99
R1694:Dnah9	UTSW	11	65954824	nonsense	probably null
R1701:Dnah9	UTSW	11	65911924	missense	probably damaging	1.00
R1702:Dnah9	UTSW	11	66085195	missense	possibly damaging	0.72
R1708:Dnah9	UTSW	11	65915154	missense	probably benign	0.11
R1718:Dnah9	UTSW	11	66168079	missense	possibly damaging	0.82
R1729:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1760:Dnah9	UTSW	11	65981222	missense	probably benign	0.31
R1784:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1793:Dnah9	UTSW	11	66119594	critical splice donor site	probably null
R1801:Dnah9	UTSW	11	65955297	missense	probably damaging	0.99
R1827:Dnah9	UTSW	11	65850061	missense	probably damaging	0.97
R1836:Dnah9	UTSW	11	66118841	missense	probably benign	0.10
R1840:Dnah9	UTSW	11	65834198	nonsense	probably null
R1847:Dnah9	UTSW	11	65834386	missense	probably damaging	1.00
R1872:Dnah9	UTSW	11	66037490	missense	probably benign	0.16
R1929:Dnah9	UTSW	11	65976398	missense	probably benign	0.05
R1969:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R1971:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R2027:Dnah9	UTSW	11	65955338	missense	probably benign	0.11
R2049:Dnah9	UTSW	11	66044683	missense	probably damaging	1.00
R2064:Dnah9	UTSW	11	66145435	missense	probably benign	0.31
R2104:Dnah9	UTSW	11	66061124	missense	probably damaging	1.00
R2109:Dnah9	UTSW	11	66037585	missense	probably damaging	1.00
R2160:Dnah9	UTSW	11	66117483	missense	probably damaging	1.00
R2172:Dnah9	UTSW	11	66072779	missense	probably damaging	1.00
R2198:Dnah9	UTSW	11	65859499	missense	possibly damaging	0.50
R2271:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2272:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2396:Dnah9	UTSW	11	66085158	missense	probably benign	0.01
R2398:Dnah9	UTSW	11	65915203	missense	probably damaging	1.00
R2418:Dnah9	UTSW	11	66095415	nonsense	probably null
R2419:Dnah9	UTSW	11	66095415	nonsense	probably null
R2510:Dnah9	UTSW	11	66005169	missense	probably damaging	1.00
R2680:Dnah9	UTSW	11	66033925	missense	probably benign	0.00
R2875:Dnah9	UTSW	11	66168461	missense	possibly damaging	0.89
R2979:Dnah9	UTSW	11	66117588	missense	possibly damaging	0.89
R3236:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3237:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3433:Dnah9	UTSW	11	66075112	missense	possibly damaging	0.85
R3737:Dnah9	UTSW	11	66156908	nonsense	probably null
R3820:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3821:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3822:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3861:Dnah9	UTSW	11	66052994	splice site	probably benign
R3918:Dnah9	UTSW	11	65870974	missense	possibly damaging	0.54
R4011:Dnah9	UTSW	11	65834464	missense	probably damaging	0.98
R4044:Dnah9	UTSW	11	66133635	missense	probably benign	0.03
R4072:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4076:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4097:Dnah9	UTSW	11	65990459	missense	probably damaging	1.00
R4409:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4410:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4417:Dnah9	UTSW	11	65981214	missense	possibly damaging	0.75
R4420:Dnah9	UTSW	11	66118749	missense	probably benign	0.00
R4434:Dnah9	UTSW	11	66108075	missense	possibly damaging	0.67
R4451:Dnah9	UTSW	11	65881641	missense	probably benign	0.07
R4452:Dnah9	UTSW	11	66027082	missense	probably damaging	0.96
R4454:Dnah9	UTSW	11	66147389	missense	probably damaging	0.96
R4551:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4552:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4590:Dnah9	UTSW	11	66040392	missense	probably damaging	1.00
R4595:Dnah9	UTSW	11	66168152	missense	probably benign
R4655:Dnah9	UTSW	11	65955732	missense	probably benign	0.00
R4667:Dnah9	UTSW	11	66155531	missense	probably benign
R4718:Dnah9	UTSW	11	66085473	missense	probably benign
R4720:Dnah9	UTSW	11	66076358	missense	probably damaging	1.00
R4734:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4749:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4765:Dnah9	UTSW	11	65927726	missense	probably damaging	1.00
R4905:Dnah9	UTSW	11	65874124	nonsense	probably null
R4963:Dnah9	UTSW	11	66084611	splice site	probably null
R5074:Dnah9	UTSW	11	65850040	missense	probably damaging	1.00
R5230:Dnah9	UTSW	11	66084666	missense	probably damaging	0.99
R5262:Dnah9	UTSW	11	66112333	missense	probably benign	0.34
R5364:Dnah9	UTSW	11	65881696	missense	possibly damaging	0.93
R5370:Dnah9	UTSW	11	66029354	missense	probably damaging	1.00
R5386:Dnah9	UTSW	11	66029356	missense	probably damaging	1.00
R5389:Dnah9	UTSW	11	66095314	nonsense	probably null
R5541:Dnah9	UTSW	11	66145336	missense	probably damaging	1.00
R5560:Dnah9	UTSW	11	65881740	missense	probably benign	0.00
R5576:Dnah9	UTSW	11	65834096	splice site	probably null
R5648:Dnah9	UTSW	11	65927755	missense	probably benign	0.00
R5653:Dnah9	UTSW	11	65849980	missense	probably damaging	0.99
R5713:Dnah9	UTSW	11	66025223	missense	possibly damaging	0.92
R5763:Dnah9	UTSW	11	65955239	missense	probably damaging	1.00
R5825:Dnah9	UTSW	11	66126601	missense	probably benign	0.01
R5831:Dnah9	UTSW	11	66108121	missense	probably benign	0.00
R5847:Dnah9	UTSW	11	66095240	frame shift	probably null
R5870:Dnah9	UTSW	11	66085210	missense	probably benign	0.01
R5902:Dnah9	UTSW	11	66025187	missense	probably benign	0.08
R5918:Dnah9	UTSW	11	65834199	missense	probably damaging	1.00
R5979:Dnah9	UTSW	11	65834481	missense	probably damaging	1.00
R6065:Dnah9	UTSW	11	65855338	missense	probably benign	0.05
R6065:Dnah9	UTSW	11	66145397	missense	possibly damaging	0.65
R6086:Dnah9	UTSW	11	65989915	missense	probably damaging	0.99
R6086:Dnah9	UTSW	11	66085174	missense	probably benign
R6102:Dnah9	UTSW	11	65990516	missense	probably damaging	0.97
R6120:Dnah9	UTSW	11	66147399	missense	probably benign
R6154:Dnah9	UTSW	11	65855338	missense	probably benign	0.00
R6262:Dnah9	UTSW	11	65881805	splice site	probably null
R6265:Dnah9	UTSW	11	66168094	missense	probably benign	0.04
R6290:Dnah9	UTSW	11	65841375	missense	probably damaging	1.00
R6345:Dnah9	UTSW	11	66037693	missense	probably damaging	0.97
R6357:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
R6534:Dnah9	UTSW	11	65955248	missense	probably damaging	0.99
R6574:Dnah9	UTSW	11	66168281	missense	probably benign	0.37
R6582:Dnah9	UTSW	11	66061097	missense	probably damaging	1.00
R6700:Dnah9	UTSW	11	65955366	missense	probably damaging	1.00
R6800:Dnah9	UTSW	11	66072739	critical splice donor site	probably null
R6812:Dnah9	UTSW	11	65981329	missense	probably damaging	0.99
R6931:Dnah9	UTSW	11	66117626	missense	possibly damaging	0.63
R6944:Dnah9	UTSW	11	66085149	missense	possibly damaging	0.91
R6958:Dnah9	UTSW	11	66076341	missense	probably damaging	1.00
R6977:Dnah9	UTSW	11	66107909	missense	probably benign	0.37
R7021:Dnah9	UTSW	11	65981231	missense	probably benign
R7161:Dnah9	UTSW	11	65855372	nonsense	probably null
R7175:Dnah9	UTSW	11	66133637	missense	probably benign	0.03
R7231:Dnah9	UTSW	11	65965647	missense	probably damaging	1.00
R7284:Dnah9	UTSW	11	65990476	missense	probably damaging	0.99
R7314:Dnah9	UTSW	11	65989851	missense	probably benign	0.00
R7350:Dnah9	UTSW	11	66080578	missense	probably damaging	1.00
R7420:Dnah9	UTSW	11	66117407	critical splice donor site	probably null
R7427:Dnah9	UTSW	11	65955219	missense	probably benign
R7477:Dnah9	UTSW	11	65992731	missense	probably damaging	0.98
R7515:Dnah9	UTSW	11	65841414	missense	probably benign	0.01
R7521:Dnah9	UTSW	11	65989837	missense	probably damaging	0.98
R7573:Dnah9	UTSW	11	66125215	missense	probably benign	0.43
R7659:Dnah9	UTSW	11	65989780	missense	probably damaging	0.99
R7707:Dnah9	UTSW	11	66118958	missense	probably damaging	1.00
R7749:Dnah9	UTSW	11	65911830	missense	probably damaging	1.00
R7792:Dnah9	UTSW	11	65850013	missense	probably damaging	1.00
R7808:Dnah9	UTSW	11	66005805	nonsense	probably null
R7814:Dnah9	UTSW	11	66005660	missense	probably damaging	1.00
R7818:Dnah9	UTSW	11	66025211	missense	possibly damaging	0.64
R7890:Dnah9	UTSW	11	66072072	missense	probably damaging	0.99
R7976:Dnah9	UTSW	11	65841401	missense	possibly damaging	0.91
R8121:Dnah9	UTSW	11	66017375	missense	probably benign	0.02
R8232:Dnah9	UTSW	11	65855323	missense	possibly damaging	0.91
R8311:Dnah9	UTSW	11	65989818	missense	probably benign	0.00
R8326:Dnah9	UTSW	11	66117626	missense	probably benign	0.01
R8338:Dnah9	UTSW	11	65841241	critical splice donor site	probably null
R8356:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8456:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8468:Dnah9	UTSW	11	65831730	missense	probably benign	0.00
R8721:Dnah9	UTSW	11	66095298	missense	probably damaging	1.00
R8747:Dnah9	UTSW	11	65927990	missense	possibly damaging	0.69
R8798:Dnah9	UTSW	11	65905231	missense	probably damaging	0.99
R8806:Dnah9	UTSW	11	65859483	missense	probably damaging	1.00
R8826:Dnah9	UTSW	11	65849916	missense	probably benign	0.13
R8837:Dnah9	UTSW	11	65855234	missense	possibly damaging	0.72
R8886:Dnah9	UTSW	11	66053014	missense	probably damaging	1.00
R8887:Dnah9	UTSW	11	65855384	missense	probably benign	0.01
R8921:Dnah9	UTSW	11	65911921	missense	probably benign
R8933:Dnah9	UTSW	11	65855252	missense	possibly damaging	0.88
R8949:Dnah9	UTSW	11	66168400	missense	possibly damaging	0.91
R8967:Dnah9	UTSW	11	66125112	critical splice donor site	probably null
R8979:Dnah9	UTSW	11	66005152	missense	probably benign
R8991:Dnah9	UTSW	11	65886680	missense	probably damaging	0.96
R9016:Dnah9	UTSW	11	66108030	missense	probably damaging	0.99
R9025:Dnah9	UTSW	11	66005825	missense	probably damaging	1.00
R9043:Dnah9	UTSW	11	65954854	missense
R9047:Dnah9	UTSW	11	66072099	missense	possibly damaging	0.89
R9076:Dnah9	UTSW	11	66117638	missense	probably benign	0.21
R9113:Dnah9	UTSW	11	65989887	missense	probably damaging	1.00
R9152:Dnah9	UTSW	11	66130631	missense	probably damaging	1.00
R9187:Dnah9	UTSW	11	66005146	missense	probably benign
R9198:Dnah9	UTSW	11	65955744	missense	probably benign	0.02
R9203:Dnah9	UTSW	11	65855287	missense	possibly damaging	0.58
R9234:Dnah9	UTSW	11	66033925	missense	possibly damaging	0.68
R9245:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R9265:Dnah9	UTSW	11	65841255	missense	probably benign	0.01
R9307:Dnah9	UTSW	11	66085474	missense	probably benign	0.14
R9336:Dnah9	UTSW	11	65870949	missense	probably damaging	1.00
R9386:Dnah9	UTSW	11	65947542	missense	probably damaging	1.00
R9498:Dnah9	UTSW	11	65848373	missense	probably damaging	0.99
R9508:Dnah9	UTSW	11	65834263	missense	probably damaging	1.00
R9524:Dnah9	UTSW	11	66085483	missense	possibly damaging	0.92
R9577:Dnah9	UTSW	11	65976521	missense	probably benign	0.00
R9583:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R9587:Dnah9	UTSW	11	66108391	missense	probably null	0.92
R9612:Dnah9	UTSW	11	65927649	missense	probably benign	0.00
R9748:Dnah9	UTSW	11	66085464	missense	possibly damaging	0.51
R9749:Dnah9	UTSW	11	66095376	missense	probably damaging	1.00
R9759:Dnah9	UTSW	11	66075118	missense	probably null	0.93
R9784:Dnah9	UTSW	11	66085134	missense	probably damaging	0.99
V3553:Dnah9	UTSW	11	65970076	missense	probably damaging	1.00
X0027:Dnah9	UTSW	11	66085479	missense	probably benign	0.07
X0028:Dnah9	UTSW	11	65990452	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65895972	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65927853	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65970084	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66037474	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66072835	missense	probably damaging	1.00
Z1177:Dnah9	UTSW	11	66126650	missense	probably damaging	1.00
Z1186:Dnah9	UTSW	11	66085174	missense	probably benign
Z1186:Dnah9	UTSW	11	66147381	missense	probably benign
Z1187:Dnah9	UTSW	11	66085174	missense	probably benign
Z1187:Dnah9	UTSW	11	66147381	missense	probably benign
Z1188:Dnah9	UTSW	11	66085174	missense	probably benign
Z1188:Dnah9	UTSW	11	66147381	missense	probably benign
Z1189:Dnah9	UTSW	11	66085174	missense	probably benign
Z1189:Dnah9	UTSW	11	66147381	missense	probably benign
Z1190:Dnah9	UTSW	11	66085174	missense	probably benign
Z1190:Dnah9	UTSW	11	66147381	missense	probably benign
Z1191:Dnah9	UTSW	11	66085174	missense	probably benign
Z1191:Dnah9	UTSW	11	66147381	missense	probably benign
Z1192:Dnah9	UTSW	11	66085174	missense	probably benign
Z1192:Dnah9	UTSW	11	66147381	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCGGAGATCAATATTTTGCAG -3'
(R):5'- CATTAGGCTTCCCTCCAAGC -3'

Sequencing Primer
(F):5'- CGGAGATCAATATTTTGCAGTTCTTC -3'
(R):5'- TGAACCATCCACCCTGATGCTG -3'

Posted On

2019-06-26